Previous Contig 006131:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028H15Sequence542006131 (4)gb:AC137608_17434796e-61Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009C07, complet
JMSF020D22Sequence691006131 (4)gb:AC137608_17434793e-84Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009C07, complet757012120 (4)pir|T01729|T017299e-64mitochondrial solute carrier protein homolog - Arabidopsis thaliana>gb:ATCHRIV3_
JMSF023D19Sequence669006131 (4)gb:AC137608_17434796e-55Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009C07, complet692012120 (4)pir|T01729|T017295e-55mitochondrial solute carrier protein homolog - Arabidopsis thaliana>gb:ATCHRIV3_
JMSF031G09Sequence670006131 (4)gb:AC137608_17434795e-73Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009C07, complet718012120 (4)pir|T01729|T017292e-66mitochondrial solute carrier protein homolog - Arabidopsis thaliana>gb:ATCHRIV3_

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF020D22+ ACTGGGTAGGAGATTTA
                      ____________________________________________________________
consensus ACTGGGTAGGAGATTTA
 
. : . : . : . : . : . :
JMSF020D22+ TCTGACTGGACAGTTAGCCGACCTCGTACCATGTCCATNGGATATGTTGCAGACATGGCA
                      ____________________________________________________________
consensus TCTGACTGGACAGTTAGCCGACCTCGTACCATGTCCATNGGATATGTTGCAGACATGGCA
 
. : . : . : . : . : . :
JMSF020D22+ ATAATTCCAGCACATGCTCCAGCACCAAGGCGTAAAATTGGAGTTAGTTCAGCCTCCTCG
                      ____________________________________________________________
consensus ATAATTCCAGCACATGCTCCAGCACCAAGGCGTAAAATTGGAGTTAGTTCAGCCTCCTCG
 
. : . : . : . : . : . :
JMSF020D22+ TTTCCAGTTTGATTGCGATAAAGCCATAAGATGCCCTTGGATGCCTGCTCATAGCTAAAA
JMSF031G09+ CTTGGATGCCTGCTCATAGCTAAAA
JMFF028H15+ CTTGGATGCCTGCTCATAGCTAAAA
JMSF023D19+ CTTGGATGCCTGCTCATAGCTAAAA
                      ____________________________________________________________
consensus TTTCCAGTTTGATTGCGATAAAGCCATAAGATGCCCTTGGATGCCTGCTCATAGCTAAAA
 
. : . : . : . : . : . :
JMSF020D22+ AATTTGACAGCAGAGTTTGGGACAATTCGTGCACAATTGGTCCCATTTCCTTTGAACAAT
JMSF031G09+ AATTTGACAGCAGAGTTTGGGACAATTCGTGCACAATTGGTCCCATTTCCTTTGAACAAT
JMFF028H15+ AATTTGACAGCAGAGTTTGGGACAATTCGTGCACAATTGGTCCCATTTCCTTTGAACAAT
JMSF023D19+ AATTTGACAGCAGAGTTTGGGACAATTCGTGCACAATTGGTCCCATTTCCTTTGAACAAT
                      ____________________________________________________________
consensus AATTTGACAGCAGAGTTTGGGACAATTCGTGCACAATTGGTCCCATTTCCTTTGAACAAT
 
. : . : . : . : . : . :
JMSF020D22+ CCCCGAAAACCCTCAGTTCTCCATATGTATTTCAATCCTTGAACTGTGCCACTGTATTTT
JMSF031G09+ CCCCGAAAACCCTCAGTTCTCCATATGTATTTCAATCCTTGAACTGTGCCACTGTATTTT
JMFF028H15+ CCCCGAAAACCCTCAGTTCTCCATATGTATTTCAATCCTTGAACTGTGCCACTGTATTTT
JMSF023D19+ CCCCGAAAACCCTCAGTTCTCCATATGTATTTCAATCCTTGAACTGTGCCACTGTATTTT
                      ____________________________________________________________
consensus CCCCGAAAACCCTCAGTTCTCCATATGTATTTCAATCCTTGAACTGTGCCACTGTATTTT
 
. : . : . : . : . : . :
JMSF020D22+ ATGCTATGAGGATTTTGAACCTGAAGAAGAATTTTTAGCCTTTCCAGCGGAGCAACTGCA
JMSF031G09+ ATGCTATGAGGATTTTGAACCTGAAGAAGAATTTTTAGCCTTTCCAGCGGAGCAACTGCA
JMFF028H15+ ATGCTATGAGGATTTTGAACCTGAAGAAGAATTTTTAGCCTTTCCAGCGGAGCAACTGCA
JMSF023D19+ ATGCTATGAGGATTTTGAACCTGAAGAAGAATTTTTAGCCTTTCCAGCGGAGCAACTGCA
                      ____________________________________________________________
consensus ATGCTATGAGGATTTTGAACCTGAAGAAGAATTTTTAGCCTTTCCAGCGGAGCAACTGCA
 
. : . : . : . : . : . :
JMSF020D22+ GTGCGTGATACTCCACCAGCGATGCCGCCGGCGGCGAGGGACTTGCAAATACTGAGCAGA
JMSF031G09+ GTGCGTGATACTCCACCAGCGATGCCGCCGGCGGCGAGGGACTTGCAAATACTGAGCAGA
JMFF028H15+ GTGCGTGATACTCCACCAGCGATGCCGCCGGCGGCGAGGGACTTGCAAATACTGAGCAGA
JMSF023D19+ GTGCGTGATACTCCACCAGCGATGCCGCCGGCGGCGAGGGACTTGCAAATACTGAGCAGA
                      ____________________________________________________________
consensus GTGCGTGATACTCCACCAGCGATGCCGCCGGCGGCGAGGGACTTGCAAATACTGAGCAGA
 
. : . : . : . : . : . :
JMSF020D22+ GCGGCGTGGGTGGGAGCCTTAACTCCTTCGCTAGCAATCTTGGCTTCCTCGGCCAGATTA
JMSF031G09+ GCGGCGTGGGTGGGAGCCTTAACTCCTTCGCTAGCAATCTTGGCTTCCTCGGCCAGATTA
JMFF028H15+ GCGGCGTGGGTGGGAGCCTTAACTCCTTCGCTAGCAATCTTGGCTTCCTCGGCCAGATTA
JMSF023D19+ GCGGCGTGGGTGGGAGCCTTAACTCCTTCGCTAGCAATCTTGGCTTCCTCGGCCAGATTA
                      ____________________________________________________________
consensus GCGGCGTGGGTGGGAGCCTTAACTCCTTCGCTAGCAATCTTGGCTTCCTCGGCCAGATTA
 
. : . : . : . : . : . :
JMSF020D22+ ACGATCGTCGACACGGCACTGTCGCTTCGCTTGCCTACGACATCCTCCGACGCCATTCAA
JMSF031G09+ ACGATCGTCGACACGGCACTGTCGCTTCGCTTGCCTACGACATCCTCCGACGCCATTCAA
JMFF028H15+ ACGATCGTCGACACGGCACTGTCGCTTCGCTTGCCTACGACATCCTCCGACGCCATTCAA
JMSF023D19+ ACGATCGTCGACACGGCACTGTCGCTTCGCTTGCCTACGACATCCTCCGACGCCATTCAA
                      ____________________________________________________________
consensus ACGATCGTCGACACGGCACTGTCGCTTCGCTTGCCTACGACATCCTCCGACGCCATTCAA
 
. : . : . : . : . : . :
JMSF020D22+ CAGCGCCACACAAATCGGGGACAGACACCCTCCGGGACATGAGCCGCCGCACGAATCGTA
JMSF031G09+ CAGCGCCACACAAATCGGGGACAGACACCCTCCGGGACCTGAGCCGCCGCACGAATCGTA
JMFF028H15+ CAGCGCCACACAAATCGGGGACAGACACCCTCCGGGACCTGAGCCGCCGCACGAATCGTA
JMSF023D19+ CAGCGCCACACAAATCGGGGACAGACACCCTCCGGGACCTGAGCCGCCGCACGAATCGTA
                      ____________________________________________________________
consensus CAGCGCCACACAAATCGGGGACAGACACCCTCCGGGACCTGAGCCGCCGCACGAATCGTA
 
. : . : . : . : . : . :
JMSF020D22+ TTGGCCGTCGGGCGATTGCGAGGGATACAAAGCGATGGAGGGAGAGGACGTTAGTTCCTT
JMSF031G09+ TTGGCCGTCGGGCGATTGCGAGGGATACAAAGCGATGGAGGGAGAGGACGTTAGTTCCTT
JMFF028H15+ TTGGCCGTCGGGCGATTGCGAGGGATACAAAGCGATGGAGGGAGAGGACGTTAGTTCCTT
JMSF023D19+ TTGGCCGTCGGGCGATTGCGAGGGATACAAAGCGATGGAGGGAGAGGACGTTAGTTCCTT
                      ____________________________________________________________
consensus TTGGCCGTCGGGCGATTGCGAGGGATACAAAGCGATGGAGGGAGAGGACGTTAGTTCCTT
 
. : . : . : . : . : . :
JMSF020D22+ TCGTGAGAAAAGC
JMSF031G09+ TCGTGAGAAAAGCAAAAAAAATAAAATAAATAAATGAACGAACACCAAAAGGTAAAAC
JMFF028H15+ TCGT
JMSF023D19+ TCGTGAGAAAAGCAAAAAAAATAAAATAAATAAATGAACGAACACCAAAAGGTAAAACGC
                      ____________________________________________________________
consensus TCGTGAGAAAAGCAAAAAAAATAAAATAAATAAATGAACGAACACCAAAAGGTAAAACGC