Previous Contig 006129:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001N01Sequence402006129 (3)gb:AB010692_15111035e-26Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18I23.730021995gb:AB010692_15111037e-43Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18I23.
JMSF023D09Sequence684006129 (3)gb:AB010692_15111031e-50Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18I23.722012292 (2)gb:AB010692_15111032e-70Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18I23.
JMSF039F09Sequence641006129 (3)gb:AB010692_15111035e-46Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18I23.845012292 (2)gb:AB010692_15111035e-88Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18I23.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023D09+ TGACTCACTATCCATCACATCAAT
                      ____________________________________________________________
consensus TGACTCACTATCCATCACATCAAT
 
. : . : . : . : . : . :
JMSF039F09+ CCAAGTCGAGGAGATTGTGAGAAGATTAAGCAGCGCAACCCAAAGGAAAAA
JMSF023D09+ TACTCTAGCCCAAGTCGAGGAGATTGTGAGAAGATTAAGCAGCGCAACCCAAAGGAAAAA
                      ____________________________________________________________
consensus TACTCTAGCCCAAGTCGAGGAGATTGTGAGAAGATTAAGCAGCGCAACCCAAAGGAAAAA
 
. : . : . : . : . : . :
JMSF039F09+ GCCAATTCTCACAGAGATGTAAAACCATCCATGGTTGCCCCACCCAGCCAAAGATGAAGG
JMSF023D09+ GCCAATTCTCACAGAGATGTAAAACCATCCATGGTTGCCCCACCCAGCCAAAGATGAAGG
                      ____________________________________________________________
consensus GCCAATTCTCACAGAGATGTAAAACCATCCATGGTTGCCCCACCCAGCCAAAGATGAAGG
 
. : . : . : . : . : . :
JMSF039F09+ AATAGTTTGGTCAACATTGACCTTCAACTCCTCTTTTACATTGGACATGGAGAGAAATCC
JMSF023D09+ AATAGTTTGGTCAAAATTGACCTTCAACTCCTCTTTTACATTGGACATGGAGAGAAATCC
                      ____________________________________________________________
consensus AATAGTTTGGTCAACATTGACCTTCAACTCCTCTTTTACATTGGACATGGAGAGAAATCC
 
. : . : . : . : . : . :
JMSF039F09+ CTTGAGATGAAAAATTGAGCTTCCCGGTGTAGAAGAAACCCACAAGGTAAAAAATACAAA
JMSF023D09+ CTTGAGATGAAAAATTGAGCTTCCCGGTGTAGAAGAAACCCACAAGGTAAAAAATACAAA
                      ____________________________________________________________
consensus CTTGAGATGAAAAATTGAGCTTCCCGGTGTAGAAGAAACCCACAAGGTAAAAAATACAAA
 
. : . : . : . : . : . :
JMSF039F09+ AAGAGAAATCGCAAAGAACCTGTGTATCAAGGCCAGAGCCTTGGCTTTGGAAAGATTAGG
JMSF001N01+ TCGCAAAGAACCTGTGTATCAAGGCCAGAGCCTTGGCTTTGGAAAGATTAGG
JMSF023D09+ AAGAGAAATCGCAAAGAACCTGTGTATCAAGGCCAGAGCCTTGGCTTTGGAAAGATTAGG
                      ____________________________________________________________
consensus AAGAGAAATCGCAAAGAACCTGTGTATCAAGGCCAGAGCCTTGGCTTTGGAAAGATTAGG
 
. : . : . : . : . : . :
JMSF039F09+ CAATGTGAAAATCAGTGTGGAAAGCGGGGCAGCAACCAATGTAAGAACTAACGATCCCAC
JMSF001N01+ CAATGTGAAAATCAGTGTGGAAAGCGGGGCAGCAACCAATGTAAGAACTAACGATCCCAC
JMSF023D09+ CAATGTGAAAATCAGTGTGGAAAGCGGGGCAGCAACCAATGTAAGAACTAACGATCCCAC
                      ____________________________________________________________
consensus CAATGTGAAAATCAGTGTGGAAAGCGGGGCAGCAACCAATGTAAGAACTAACGATCCCAC
 
. : . : . : . : . : . :
JMSF039F09+ AAATAAACCTGGTAAATTCCCTAACCCTAACGACATTGCGCCATCATCTCGTAAAGGAAG
JMSF001N01+ AAATAAACCTGGTAAATTCCCTAACCCTAACGACATTGCGCCATCATCTCGTAAAGGAAG
JMSF023D09+ AAATAAACCTGGTAAATTCCCTAACCCTAACGACATTGCGCCATCATCTCGTAAAGGAAG
                      ____________________________________________________________
consensus AAATAAACCTGGTAAATTCCCTAACCCTAACGACATTGCGCCATCATCTCGTAAAGGAAG
 
. : . : . : . : . : . :
JMSF039F09+ AACTACAAAATACGCACTTAGAATGAAGAAGAAAGTGGAGGCGGAAGATAGCAAAGCCGA
JMSF001N01+ AACTACAAAATACGCACTTAGAATGAAGAAGAAAGTGGAGGCGGAAGATAGCAAAGCCGA
JMSF023D09+ AACTACAAAATACGCACTTAGAATGAAGAAGAAAGTGGAGGCGGAAGATAGCAAAGCCGA
                      ____________________________________________________________
consensus AACTACAAAATACGCACTTAGAATGAAGAAGAAAGTGGAGGCGGAAGATAGCAAAGCCGA
 
. : . : . : . : . : . :
JMSF039F09+ GGTTTCGTGAGGGTGAACAGTGACGAACCACGACAAGATTGCGTGTGATCGAGGAGTTTT
JMSF001N01+ GGTTTCGTGAGGGTGAACAGTGACGAACCACGACAAGATTGCGTGTGATCGAGGAGTTTT
JMSF023D09+ GGTTTCGTGAGGGTGAACAGTGACGAACCACGACAAGATTGCGTGTGATCGAGGAGTTTT
                      ____________________________________________________________
consensus GGTTTCGTGAGGGTGAACAGTGACGAACCACGACAAGATTGCGTGTGATCGAGGAGTTTT
 
. : . : . : . : . : . :
JMSF039F09+ AGCCTCCATATTCATCGCCTTCCCCTTGTACCTCTCACTGGAATTCTTACGCCCTAAAGA
JMSF001N01+ AGCCTCCATATTCATCGCCTTCCCCTTGTACCTCTCACTGGAATTCTTACGCCCTAAAGA
JMSF023D09+ AGCCTCCATATTCATCGCCTTCCCCTTGTACCTCTCACTGGAATTCTTACGCCCTAAAGA
                      ____________________________________________________________
consensus AGCCTCCATATTCATCGCCTTCCCCTTGTACCTCTCACTGGAATTCTTACGCCCTAAAGA
 
. : . : . : . : . : . :
JMSF039F09+ ATTTAGTGTGTTGTTTTCTCTTTCTCTACCAAAACTTCCATGGATC
JMSF001N01+ ATTTAGTGTGTTGTTTTCTCTTTCTCTACCAAAACTTCCATGGATC
JMSF023D09+ ATTTAGTGTGTTGTTTTCTCTTTCTCTACCAAAACTTCCATGGATCCTCATCAGAAAACC
                      ____________________________________________________________
consensus ATTTAGTGTGTTGTTTTCTCTTTCTCTACCAAAACTTCCATGGATCCTCATCAGAAAACC