Previous Contig 006127:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017N01Sequence544006127 (5)gb:AY088284_15733042e-66Arabidopsis thaliana clone 5176 mRNA, complete sequence.660006127 (5)gb:AY088284_15733041e-65Arabidopsis thaliana clone 5176 mRNA, complete sequence.
JMFN008I01Sequence615006127 (5)gb:AK175690_18176782e-61Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-21-C20.>gb:AK176539_18185
JMFS050G12Sequence544006127 (5)gb:AK175690_18176781e-62Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-21-C20.>gb:AK176539_18185
JMSF023C20Sequence725006127 (5)gb:AY088284_15733041e-67Arabidopsis thaliana clone 5176 mRNA, complete sequence.147009852 (10)sp|P41127|RL13_ARATH4e-1060S ribosomal protein L13 (BBC1 protein homolog).>pir|S37271|S37271 ribosomal pr

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017N01- AATACTTCATTGTAAAGAA
                      ____________________________________________________________
consensus AATACTTCATTGTAAAGAA
 
. : . : . : . : . : . :
rJMFF017N01- TCATGAGTGCTTGGAGTAAATTTTTATTTTTAAAATTTGCAATAAGGGTTAGATATGAAC
                      ____________________________________________________________
consensus TCATGAGTGCTTGGAGTAAATTTTTATTTTTAAAATTTGCAATAAGGGTTAGATATGAAC
 
. : . : . : . : . : . :
rJMFF017N01- AAGACAAATATGTAAAAGGCTAAAGCGACACAGAAACATCGAAAGCTCTTCCCAGGCGCA
JMFF017N01+ TCTTCCCAGGCGCA
JMSF023C20+ GGCGCA
                      ____________________________________________________________
consensus AAGACAAATATGTAAAAGGCTAAAGCGACACAGAAACATCGAAAGCTCTTCCCAGGCGCA
 
. : . : . : . : . : . :
rJMFF017N01- GCGGCTTGGCATCAGAGACAATGGGACTGCCCAAAGACTCAACTGTAGAGTTGTTGAAGC
JMFF017N01+ GCGGCTTGGCATCAGAGACAATGGGACTGCCCAAAGACTCAACTGTAGAGTTGTTGAAGC
JMSF023C20+ GCGGCTT-GCATCAGAGACAATGGGACTGCCCAAAGACTCAACTGTAGAGTTGTTGAAGC
                      ____________________________________________________________
consensus GCGGCTTGGCATCAGAGACAATGGGACTGCCCAAAGACTCAACTGTAGAGTTGTTGAAGC
 
. : . : . : . : . : . :
rJMFF017N01- AGTAGAGGGGGGCTTGCCAATTTGGGTCCGACAGAACTTTTCCCACTTCAAATGTCATCA
JMFF017N01+ AGTAGAGGGGGGCTTGCCAATTTGGGTCCGACAGAACTTTTCCCACTTCAAATGTCATCA
JMFN008I01+ GGGTCCGACAGAACTTTTCCCACTTCAAATGTCATCA
JMFS050G12+ CCAATTTGGGTCTGACAGAACTTTTCCCACTTCAAATGTCATCA
JMSF023C20+ AGTAGAGGGGGGCTTGCCAATTTGGGTCCGACAGAACTTTTCCCACTTCAAATGTCATCA
                      ____________________________________________________________
consensus AGTAGAGGGGGGCTTGCCAATTTGGGTCCGACAGAACTTTTCCCACTTCAAATGTCATCA
 
. : . : . : . : . : . :
rJMFF017N01- CATGTGCCACCATTCCTGTGTAGAAAGCCCAATAAACAGGTCTTTTAGAGACGACATCCT
JMFF017N01+ CATGTGCCACCATTCCTGTGTAGAAAGCCCAATAAACAGGTCTTTTAGAGACGACATCCT
JMFN008I01+ CATGTGCCACCATTCCTGTGTAGAAAGCCCAATAAACAGGTCTTTTAGAGACGACATCCT
JMFS050G12+ CATGTGCCACCATTCCTGTGTAGAAAGCCCAATAAACAGGTCTTTTAGAGACGACATCCT
JMSF023C20+ CATGTGCCACCATTCCTGTGTAGAAAGCCCAATAAACAGGTCTTTTAGAGACGACATCCT
                      ____________________________________________________________
consensus CATGTGCCACCATTCCTGTGTAGAAAGCCCAATAAACAGGTCTTTTAGAGACGACATCCT
 
. : . : . : . : . : . :
rJMFF017N01- CGTAGTACCAGATAAACTCAACCTTCTCCCACACATTACACAGGAACCCATCCATGTACT
JMFF017N01+ CGTAGTACCAGATAAACTCAACCTTCTCCCACACATTACACAGGAACCCATCCATGTACT
JMFN008I01+ CGTAGTACCAGATAAACTCAACCTTCTCCCACACATTACACAGGAACCCATCCATGTACT
JMFS050G12+ CGTAGTACCAGATAAACTCAACCTTCTCCCACACATTACACAGGAACCCATCCATGTACT
JMSF023C20+ CGTAGTACCAGATAAACTCAACCTTCTCCCACACATTACACAGGAACCCATCCATGTACT
                      ____________________________________________________________
consensus CGTAGTACCAGATAAACTCAACCTTCTCCCACACATTACACAGGAACCCATCCATGTACT
 
. : . : . : . : . : . :
rJMFF017N01- TCTGACCCAGGTAGTTCGCCCCATCAAGCCAGTCGGGTCTGAGGATGCCCACCGGCACGT
JMFF017N01+ TCTGACCCAGGTAGTTCGCCCCATCAAGCCAGTCGGGTCTGAGGATGCCCACCGGCACGT
JMFN008I01+ TCTGACCCAGGTAGTTCGCCCCATCAAGCCAGTCGGGTCTGAGGATGCCCACCGGCACGT
JMFS050G12+ TCTGACCCAGGTAGTTCGCCCCATCAAGCCAGTCGGGTCTGAGGATGCCCACCGGCACGT
JMSF023C20+ TCTGACCCAGGTAGTTCGCCCCATCAAGCCAGTCGGGTCTGAGGATGCCCACCGGCACGT
                      ____________________________________________________________
consensus TCTGACCCAGGTAGTTCGCCCCATCAAGCCAGTCGGGTCTGAGGATGCCCACCGGCACGT
 
. : . : . : . : . : . :
rJMFF017N01- CCAATACTTGGCACTCGCGGCTCGAGTCCAACGTGTATATGAAGGATGTCCCGTTGTTCC
JMFF017N01+ CCAATACTTGGCACTCGCGGCTCGAGTCCAACGTGTATATGAAGGATGTCCCGTTGTTCC
JMFN008I01+ CCAATACTTGGCACTCGCGGCTCGAGTCCAACGTGTATATGAAGGATGTCCCGTTGTTCC
JMFS050G12+ CCAATACTTGGCACTCGCGGCTCGAGTCCAACGTGTATATGAAGGATGTCCCGTTGTTCC
JMSF023C20+ CCAATACTTGGCACTCGCGGCTCGAGTCCAACGTGTATATGAAGGATGTCCCGTTGTTCC
                      ____________________________________________________________
consensus CCAATACTTGGCACTCGCGGCTCGAGTCCAACGTGTATATGAAGGATGTCCCGTTGTTCC
 
. : . : . : . : . : . :
rJMFF017N01- ATTCCAGGTCGTACACGAGGTTACCCAGCTGGTTCTGGATGATGTTGAAGTTCCTGCCGT
JMFF017N01+ ATTCCAGGTCGTACACGAGGTTACCCAGCTGGTTCTGGATGATGTTGAAGTTCCTGCCGT
JMFN008I01+ ATTCCAGGTCGTACACGAGGTTACCCAGCTGGTTCTGGATGATGTTGAAGTTCCTGCCGT
JMFS050G12+ ATTCCAGGTCGTACACGAGGTTACCCAGCTGGTTCTGGATGATGTTGAAGTTCCTGCCGT
JMSF023C20+ ATTCCAGGTCGTACACGAGGTTACCCAGCTGGTTCTGGATGATGTTGAAGTTCCTGCCGT
                      ____________________________________________________________
consensus ATTCCAGGTCGTACACGAGGTTACCCAGCTGGTTCTGGATGATGTTGAAGTTCCTGCCGT
 
. : . : . : . : . : . :
rJMFF017N01- TGGGCCAATCGTACCAGAGATCAATCATCTGCAGAGTGCCCTTGCTGGTGATGTTGACGA
JMFF017N01+ TGGGCCAATCGTACCAGAGATCAATCATCTGCAGAGTGCCCTTGCTGGTGATGTTGACGA
JMFN008I01+ TGGGCCAATCGTACCAGAGATCAATCATCTGCAGAGTGCCCTTGCTGGTGATGTTGATGA
JMFS050G12+ TGGGCCAATCGTACCAGAGATCAATCATCTGCAGAGTGCCCTTGCTGGTGATGTTGATGA
JMSF023C20+ TGGGCCAATCGTACCAGAGATCAATCATCTGCAGAGTGCCCTTGCTGGTGATGTTGATGA
                      ____________________________________________________________
consensus TGGGCCAATCGTACCAGAGATCAATCATCTGCAGAGTGCCCTTGCTGGTGATGTTGATGA
 
. : . : . : . : . : . :
rJMFF017N01- AGAGGATTGAGTGGAATTGCAGCGGCCATGGGG
JMFF017N01+ AGAGGATTGAGTGGAATTGCAGCGGCCATGGGGTGGGGAC
JMFN008I01+ AGAGGATTGAGTGGAATTGCAGCGGCCATGGGGTGGGGACCGGCTCCGGATCTCCGGCAT
JMFS050G12+ AGAGGATTGAGTGGAATTGCAGCGGCCATGGGGTGGGGACCGGCTCCGGATCTCCGGCAT
JMSF023C20+ AGAGGATTGAGTGGAATTGCAGCGGCCATGGGGTGGGGACCGGCTCCGGATCTCCGGCAT
                      ____________________________________________________________
consensus AGAGGATTGAGTGGAATTGCAGCGGCCATGGGGTGGGGACCGGCTCCGGATCTCCGGCAT
 
. : . : . : . : . : . :
JMFN008I01+ TCGGGTTTGATTCGGTCGAGGAGAAGAAGAAGAAGAGGGATGCGAGGGTGAGGGCGGAGA
JMFS050G12+ TCGGGTTTGATTCGGTCGAGGAGAAGAAGAAGAAGAGGGATGCGAGGGTGAGGGCGGAGA
JMSF023C20+ TCGGGTTTGATTCGGTCGAGGAGAAGAAGAAGAAGAGGGATGCGAGGGTGAGGGCGGAGA
                      ____________________________________________________________
consensus TCGGGTTTGATTCGGTCGAGGAGAAGAAGAAGAAGAGGGATGCGAGGGTGAGGGCGGAGA
 
. : . : . : . : . : . :
JMFN008I01+ TGATGAAGGGGAGAGTGGAGATTTTGGGGTTTCTTGAAAACTGCATTTCTTGTTTGGAAA
JMFS050G12+ TGATGAAGGGGAGAGTGGAG
JMSF023C20+ TGATGAAGGGGAGAGTGGAGATTTTGGGGTTTCTTGAAAACTGCATTTCTTGTTTGGAAA
                      ____________________________________________________________
consensus TGATGAAGGGGAGAGTGGAGATTTTGGGGTTTCTTGAAAACTGCATTTCTTGTTTGGAAA
 
. : . : . : . : . : . :
JMFN008I01+ AAGAATGGTAATGAGTGGACATAGATAAGGTTGTTCTA
JMSF023C20+ AAGAATGGTAATGAGTGGACATAGATAAGGTTGTTCTAGTTAGATTCTACGGAGTACTCA
                      ____________________________________________________________
consensus AAGAATGGTAATGAGTGGACATAGATAAGGTTGTTCTAGTTAGATTCTACGGAGTACTCA