Previous Contig 006125:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS045G10Sequence512006125 (4)gb:AX128568_14617682e-21Sequence 1 from Patent WO0131025.
JMFS068E06Sequence642006125 (4)gb:AX128568_14617684e-44Sequence 1 from Patent WO0131025.
JMSF023C15Sequence701006125 (4)gb:AX128568_14617681e-44Sequence 1 from Patent WO0131025.562023067gb:AX128570_14617694e-33Sequence 3 from Patent WO0131025.
JMSF047K18Sequence125006125 (4)gb:AX128568_14617686e-07Sequence 1 from Patent WO0131025.627013729 (2)gb:AX128570_14617696e-62Sequence 3 from Patent WO0131025.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS068E06+ CTGCATTGGCAGACCAAGCTGTAGTGAAAGACAAGCGT
JMSF023C15+ AAACTGCATTGGCAGACCAAGCTGTAGTGAAAGACAAGCGT
                      ____________________________________________________________
consensus AAACTGCATTGGCAGACCAAGCTGTAGTGAAAGACAAGCGT
 
. : . : . : . : . : . :
JMSF047K18+ AGAAAACTT
JMFS068E06+ GGACCAACTTCCACAATAACTGCATCTAAATGTTTTGTCTTATCAATATGTAGAAAACTT
JMSF023C15+ GGACCAACTTCCACAATAACTGCATCTAAATGTTTTGTCTTATCAATATGTAGAAAACTT
                      ____________________________________________________________
consensus GGACCAACTTCCACAATAACTGCATCTAAATGTTTTGTCTTATCAATATGTAGAAAACTT
 
. : . : . : . : . : . :
JMSF047K18+ TCAGTCCCCAAATTCTCAGGCTCATATGTCTNTCCCAAAACCCACTTAAGCACGGCATGC
JMFS068E06+ TCAGTCCCCAAATTCTCAGGCTCATATGTCTCTCCCAAAACCCACTTAAGCACGGCATGC
JMFS045G10+ CATGC
JMSF023C15+ TCAGTCCCCAAATTCTCAGGCTCATATGTCTCTCCCAAAACCCACTTAAGCACGGCATGC
                      ____________________________________________________________
consensus TCAGTCCCCAAATTCTCAGGCTCATATGTCTCTCCCAAAACCCACTTAAGCACGGCATGC
 
. : . : . : . : . : . :
JMSF047K18+ TTCTCACTTGAAAGATCTGAATTCAAACCAATATTG
JMFS068E06+ TTCTCACTTGAAAGATCTGAATTCAAACCAATATTGAAACACTGCTCAGTTTTCAAGCCA
JMFS045G10+ TTCTCACTTGAAAGATCTGAATTCAAACCAATATTGAAACACTGCTCAGTTTTCAAGCCA
JMSF023C15+ TTCTCACTTGAAAGATCTGAATTCAAACCAATATTGAAACACTGCTCAGTTTTCAAGCCA
                      ____________________________________________________________
consensus TTCTCACTTGAAAGATCTGAATTCAAACCAATATTGAAACACTGCTCAGTTTTCAAGCCA
 
. : . : . : . : . : . :
JMFS068E06+ ATTATTTGATGTGAGAATTTTGTTTGAACCAACTTGAGAAGTTCTGCAGTTGCACTATCT
JMFS045G10+ ATTATTTGATGTGAGAATTTTGTTTGAACCAACTTGAGAAGTTCTGCAGTTGCACTATCT
JMSF023C15+ ATTATTTGATGTGAGAATTTTGTTTGAACCAACTTGAGAAGTTCTGCAGTTGCACTATCT
                      ____________________________________________________________
consensus ATTATTTGATGTGAGAATTTTGTTTGAACCAACTTGAGAAGTTCTGCAGTTGCACTATCT
 
. : . : . : . : . : . :
JMFS068E06+ TGAAGCAACGGGACGCGATAAAAATGAACAACATTTTCTGCAGGCTGTTGAACCTTGCTT
JMFS045G10+ TGAAGCAACGGGACGCGATAAAAATGAACAACATTTTCTGCAGGCTGTTGAACCTTGCTT
JMSF023C15+ TGAAGCAACGGGACGCGATAAAAATGAACAACATTTTCTGCAGGCTGTTGAACCTTGCTT
                      ____________________________________________________________
consensus TGAAGCAACGGGACGCGATAAAAATGAACAACATTTTCTGCAGGCTGTTGAACCTTGCTT
 
. : . : . : . : . : . :
JMFS068E06+ GCCTCCTCACCTAGCAATGTGTTTACATTCCCAGAAACTACTGCTTTGACCTTTGCAGAA
JMFS045G10+ GCCTCCTCACCTAGCAATGTGTTTACATTCCCAGAAACTACTGCTTTGACCTTTGCAGAA
JMSF023C15+ GCCTCCTCACCTAGCAATGTGTTTACATTCCCAGAAACTACTGCTTTGACCTTTGCAGAA
                      ____________________________________________________________
consensus GCCTCCTCACCTAGCAATGTGTTTACATTCCCAGAAACTACTGCTTTGACCTTTGCAGAA
 
. : . : . : . : . : . :
JMFS068E06+ AGATTTGATCGTACTCCGGCATTTTTATTAGTAAACTTGAGAGGACCTTGCCTTGCAGTT
JMFS045G10+ AGATTTGATCGTACTCCGGCATTTTTATTAGTAAACTTGAGAGGACCTTGCCTTGCAGTT
JMSF023C15+ AGATTTGATCGTACTCCGGCATTTTTATTAGTAAACTTGAGAGGACCTTGCCTTGCAGTT
                      ____________________________________________________________
consensus AGATTTGATCGTACTCCGGCATTTTTATTAGTAAACTTGAGAGGACCTTGCCTTGCAGTT
 
. : . : . : . : . : . :
JMFS068E06+ ACACCCCAAAGCAAGTTCTGCCTAACTGAATGCCTTGATAAAGCTATTTTCTGTCTGTTT
JMFS045G10+ ACACCCCAAAGCAAGTTCTGCCTAACTGAATGCCTTGATAAAGCTATTTTCTGTTTGTTT
JMSF023C15+ ACACCCCAAAGCAAGTTCTGCCTAACTGAATGCCTTGATAAAGCTATTTTCTGTCTGTTT
                      ____________________________________________________________
consensus ACACCCCAAAGCAAGTTCTGCCTAACTGAATGCCTTGATAAAGCTATTTTCTGTCTGTTT
 
. : . : . : . : . : . :
JMFS068E06+ GAGCCCAACAAAAATTCTTTTGCTGCAACATTCCAAGCAGTAGCCTCCATGGCGTCTACC
JMFS045G10+ GAGCCCAACAAAAATTCTTTTGCTGCAACATTCCAAGCAGTAGCCTCCATGGCGTCTACC
JMSF023C15+ GAGCCCAACAAAAATTCTTTTGCTGCAACATTCCAAGCAGTAGCCTCCATGGCGTCTACC
                      ____________________________________________________________
consensus GAGCCCAACAAAAATTCTTTTGCTGCAACATTCCAAGCAGTAGCCTCCATGGCGTCTACC
 
. : . : . : . : . : . :
JMFS068E06+ TTGGATTGAAAAGAAGATAGCAACGAAGATTCCAACGGTACGAGGATGAACTGCTAAACG
JMFS045G10+ TTGGATTGAAAAGAAGATAGCAACGAAGATTCCAACGGGACGAGGATGAANTGGTAAACG
JMSF023C15+ TTGGATTGAAAAGAAGATAGCAACGAAGATTCCAACGGTACGAGGATGAACTGCTAAACG
                      ____________________________________________________________
consensus TTGGATTGAAAAGAAGATAGCAACGAAGATTCCAACGGTACGAGGATGAACTGCTAAACG
 
. : . : . : . : . : . :
JMFS068E06+ TTAG
JMFS045G10+ TTAGAGCCCAAGNNAAGGCTTGAAAAC
JMSF023C15+ TTAGAGCCCAAGCTAAGGCTTGAAAACATGGCGAGACCCAAATGTTGAGAGAAGCCACTC
                      ____________________________________________________________
consensus TTAGAGCCCAAGCTAAGGCTTGAAAACATGGCGAGACCCAAATGTTGAGAGAAGCCACTC