Previous Contig 006120:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051A05Sequence566006120 (2)gb:AP005524_18534455e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P056403021921
JMSF023C02Sequence679006120 (2)gb:AP005524_18534457e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P056

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023C02+ CGGTTTCCAACTGATATATC
                      ____________________________________________________________
consensus CGGTTTCCAACTGATATATC
 
. : . : . : . : . : . :
JMSF023C02+ ACACTCAATCCCAGTTCCACTATCAACAACTTTCAGAACAGGCACAATAGCACGGGTAAT
                      ____________________________________________________________
consensus ACACTCAATCCCAGTTCCACTATCAACAACTTTCAGAACAGGCACAATAGCACGGGTAAT
 
. : . : . : . : . : . :
JMFF051A05+ ACGCTGAAGTATATAAAGCTTCTTTGCAAGCTT
JMSF023C02+ TGGGTTCACACCATAAACATGTCCACTACGCTGAAGTATATAAAGCTTCTTTGCAAGCTT
                      ____________________________________________________________
consensus TGGGTTCACACCATAAACATGTCCACTACGCTGAAGTATATAAAGCTTCTTTGCAAGCTT
 
. : . : . : . : . : . :
JMFF051A05+ CTGGAGAGTCTGAATCTTCCTGGCACGCGTGATGTCAACCTTTCTAAAATTAACAGATAG
JMSF023C02+ CTTGAGAGTCTGAATCTTCCTGGCACGCGTGATGTCAACCTTTCTAAAATTAACAGATAG
                      ____________________________________________________________
consensus CTTGAGAGTCTGAATCTTCCTGGCACGCGTGATGTCAACCTTTCTAAAATTAACAGATAG
 
. : . : . : . : . : . :
JMFF051A05+ ATCTAGGTCACTTTTTGCTTCAAACAGATCCATTGTGAAAGACCCAAACTCCACAACACA
JMSF023C02+ ATCTAGGTCACTTTTTGCTTCAAACAGATCCATTGTGAAAGACCCAAACTCCACAACACA
                      ____________________________________________________________
consensus ATCTAGGTCACTTTTTGCTTCAAACAGATCCATTGTGAAAGACCCAAACTCCACAACACA
 
. : . : . : . : . : . :
JMFF051A05+ AGGAAAATCACCAGAGCAACCATAAATTTCCTTGACAATTTCATTAATTATGCGGACCAA
JMSF023C02+ AGGAAAATCACCAGAGCAACCATAAATTTCCTTGACAATTTCATTAATTATGCGGACCAA
                      ____________________________________________________________
consensus AGGAAAATCACCAGAGCAACCATAAATTTCCTTGACAATTTCATTAATTATGCGGACCAA
 
. : . : . : . : . : . :
JMFF051A05+ ATCTCTCCGAGCATCATATTCACGTGGTTTAGGGAACAGAACTAAACAAACACCATGAAG
JMSF023C02+ ATCTCTCCGAGCATCATATTCACTTGGTTTAGGGAACAGAACTAAACAAACACCATGAAG
                      ____________________________________________________________
consensus ATCTCTCCGAGCATCATATTCACTTGGTTTAGGGAACAGAACTAAACAAACACCATGAAG
 
. : . : . : . : . : . :
JMFF051A05+ CAATTCGTCCAACCCATATGACTTTTCCAAGGCTATTTTATACTTGAGCAATGTCTTCCT
JMSF023C02+ CAATTCGTCCAACCCATATGACTTTTCCAAGGCTATTTTATACTTGAGCAATGTCTTCCT
                      ____________________________________________________________
consensus CAATTCGTCCAACCCATATGACTTTTCCAAGGCTATTTTATACTTGAGCAATGTCTTCCT
 
. : . : . : . : . : . :
JMFF051A05+ CTGGCACTTGGCAGCTTCCTCGCGCAGAACTTCTACTGTAAATGACATGGTCTGGAAGTT
JMSF023C02+ CTGGCACTTGGCAGCTTCCTCGAGCAGAACTTCTACTGTAAATGACATGGTCTGGAAGTT
                      ____________________________________________________________
consensus CTGGCACTTGGCAGCTTCCTCGCGCAGAACTTCTACTGTAAATGACATGGTCTGGAAGTT
 
. : . : . : . : . : . :
JMFF051A05+ ACAAGCTGATAATATCAATTCACTGTCGTCAGTATTTGTTCGATAACTTCTCTCAGAGGA
JMSF023C02+ ACAAGCTGATAATATCAATTCACTGTCGTCA-AATTTGTTCGATAACTTCTCTCAGAGGA
                      ____________________________________________________________
consensus ACAAGCTGATAATATCAATTCACTGTCGTCAGTATTTGTTCGATAACTTCTCTCAGAGGA
 
. : . : . : . : . : . :
JMFF051A05+ ACTGCTTCAAAGGCAGTAACTGCTTCGGCGAATCCAGTAATGATTGAACAAGGGCCTGGT
JMSF023C02+ ACTGCTTCAAAGGCAGTAACTGCTTCGGCGAATCCAGTAATGATTGAACAAGGGCCTGGT
                      ____________________________________________________________
consensus ACTGCTTCAAAGGCAGTAACTGCTTCGGCGAATCCAGTAATGATTGAACAAGGGCCTGGT
 
. : . : . : . : . : . :
JMFF051A05+ CGGCTGTTTTCTTCTCCGCGCTTTGTCTTTTAGAATACTGGGATGGGATTACT
JMSF023C02+ CGGCTGTTTTCTTCTCCGCGCTTTGTCTTTTAGAATACTGGGATGGGATTACTGCTTTGC
                      ____________________________________________________________
consensus CGGCTGTTTTCTTCTCCGCGCTTTGTCTTTTAGAATACTGGGATGGGATTACTGCTTTGC