Previous Contig 006111:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034I12Sequence626006111 (8)gb:AK118468_18164452e-19Arabidopsis thaliana At1g13570 mRNA for unknown protein, complete cds, clone: RA
JMSF022P18Sequence628006111 (8)gb:AK118468_18164456e-19Arabidopsis thaliana At1g13570 mRNA for unknown protein, complete cds, clone: RA703006111 (8)
JMSF023O21Sequence628006111 (8)gb:AK118468_18164453e-20Arabidopsis thaliana At1g13570 mRNA for unknown protein, complete cds, clone: RA720006111 (8)
JMSF026O15Sequence608006111 (8)gb:AK118468_18164453e-20Arabidopsis thaliana At1g13570 mRNA for unknown protein, complete cds, clone: RA800023252
JMSF044J07Sequence769006111 (8)gb:AK118468_18164452e-22Arabidopsis thaliana At1g13570 mRNA for unknown protein, complete cds, clone: RA829006111 (8)gb:AK118468_18164452e-04Arabidopsis thaliana At1g13570 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044J07- AGCTAGGAAGTCCATATAGGGTATTC
                      ____________________________________________________________
consensus AGCTAGGAAGTCCATATAGGGTATTC
 
. : . : . : . : . : . :
rJMSF022P18- CTTCATACATGAGATGGTACTAATCCAACCTAATTTCAAACT
rJMSF023O21- CTTCATACATGAGATGGTACTAATCCAACCTAATTTCAAACT
rJMSF044J07- TTTGAATAAAATAAGGAACTTCATACATGAGATGGTACTAATCCAACCTAATTTCAAACT
                      ____________________________________________________________
consensus TTTGAATAAAATAAGGAACTTCATACATGAGATGGTACTAATCCAACCTAATTTCAAACT
 
. : . : . : . : . : . :
rJMSF022P18- GCCAAACTGAAAACTTTAACCACATAATAATTATGTCACAAGTTCAGAATATGATTTGTG
rJMSF023O21- GCCAAACTGAAAACTTTAACCACATAATAATTATGTCACAAGTTCAGAATATGATTTGTG
rJMSF044J07- GCCAAACTGAAAACTTTAACCACATAATAATTATGTCACAAGTTCAGAATATGATTTGTG
                      ____________________________________________________________
consensus GCCAAACTGAAAACTTTAACCACATAATAATTATGTCACAAGTTCAGAATATGATTTGTG
 
. : . : . : . : . : . :
rJMSF022P18- CTTTTCTTGAAGCTCGAGGGAATACCACTAACTCTTTCAAAATATTAGAGACCTCCGATG
rJMSF023O21- CTTTTCTTGAAGCTCGAGGGAATACCACTAACTCTTTCAAAATATTAGAGACCTCCGATG
rJMSF044J07- CTTTTCTTGAAGCTCGAGGGAATACCACTAACTCTTTCAAAATATTAGAGACCTCCGATG
                      ____________________________________________________________
consensus CTTTTCTTGAAGCTCGAGGGAATACCACTAACTCTTTCAAAATATTAGAGACCTCCGATG
 
. : . : . : . : . : . :
rJMSF022P18- CCTCTACTACTTTCTTGTCCTCAAAACTAACCCTTTTTAAGGCCGGGCAGCACGCGAGTA
rJMSF023O21- CCTCTACTACTTTCTTGTCCTCAAAACTAACCCTTTTTAAGGCCGGGCAGCACGCGAGTA
rJMSF044J07- CCTCTACTACTTTCTTGTCCTCAAAACTAACCCTTTTTAAGGCCGGGCAGCACGCGAGTA
                      ____________________________________________________________
consensus CCTCTACTACTTTCTTGTCCTCAAAACTAACCCTTTTTAAGGCCGGGCAGCACGCGAGTA
 
. : . : . : . : . : . :
rJMSF022P18- TTAGCTTTACAAAAAGCATTTCAGCTCTTGACCCCTGGAAATATTTGATCTTCAAAGCCC
rJMSF023O21- TTAGCTTTACAAAAAGCATTTCAGCTCTTGACCCCTGGAAATATTTGATCTTCAAAGCCC
rJMSF044J07- TTAGCTTTACAAAAAGCATTTCAGCTCTTGACCCCTGGAAATATTTGATCTTCAAAGCCC
                      ____________________________________________________________
consensus TTAGCTTTACAAAAAGCATTTCAGCTCTTGACCCCTGGAAATATTTGATCTTCAAAGCCC
 
. : . : . : . : . : . :
rJMSF022P18- GCAAACTGTTAATCTCTTCGCTCATGCAGCTACGTTCTTGCAAATACTGTAAAACGAGGT
rJMSF023O21- GCAAACTGTTAATCTCTTCGCTCATGCAGCTACGTTCTTGCAAATACTGTAAAACGAGGT
rJMSF044J07- GCAAACTGTTAATCTCTTCGCTCATGCAGCTACGTTCTTGCAAATACTGTAAAACGAGGT
                      ____________________________________________________________
consensus GCAAACTGTTAATCTCTTCGCTCATGCAGCTACGTTCTTGCAAATACTGTAAAACGAGGT
 
. : . : . : . : . : . :
rJMSF022P18- TGTTGTCAGCAGCCTCTGTAGGA--------------ACGTCCATCATAATTTCAAGGCT
rJMSF023O21- TGTTGTCAGCAGCCTCTGTAGGAACCATAAGTTTCTCACGTCCATCATAATTTCAAGGCT
rJMSF044J07- TGTTGTCAGCAGCCTCTGTAGGA--------------ACGTCCATCATAATTTCAAGGCT
                      ____________________________________________________________
consensus TGTTGTCAGCAGCCTCTGTAGGA--------------ACGTCCATCATAATTTCAAGGCT
 
. : . : . : . : . : . :
rJMSF022P18- ATGCACCCTAAGAGAGCTGTGAAGCAAGCAAAGGCTGCTGGAGACTTGTACCAGATCGGT
rJMSF023O21- ATGCACCCTAAGAGAGCTGTGAAGCAAGCAAAGGCTGCTGGAGACTTGTACCAGATCGGT
rJMSF044J07- ATGCACCCTAAGAGAGCTGTGAAGCAAGCAAAGGCTGCTGGAGACTTGTACCAGATCGGT
                      ____________________________________________________________
consensus ATGCACCCTAAGAGAGCTGTGAAGCAAGCAAAGGCTGCTGGAGACTTGTACCAGATCGGT
 
. : . : . : . : . : . :
rJMSF022P18- AAAGTTAATTTGAAATAGTCTAAGATCCCTCAACTTGTTGATTTTAACTGGAAGTGCACT
rJMSF023O21- AAAGTTAATTTGAAATAGTCTAAGATCCCTCAACTTGTTGATTTTAACTGGAAGTGCACT
rJMSF044J07- AAAGTTAATTTGAAATAGTCTAAGATCCCTCAACTTGTTGATTTTAACTGGAAGTGCACT
                      ____________________________________________________________
consensus AAAGTTAATTTGAAATAGTCTAAGATCCCTCAACTTGTTGATTTTAACTGGAAGTGCACT
 
. : . : . : . : . : . :
rJMSF022P18- CATAATAGAGC-------------CTTGAGATGGTATCCATCCATATAAAGGGTTGAAAT
rJMSF023O21- CATAATAGAGCCTGCAGCCAAAAGCTT
rJMSF044J07- CATAATAGAGCCTGCAGCCAAAAGCTTGAGATGGTATCCATCCATATAAAGGGTTGAAAT
                      ____________________________________________________________
consensus CATAATAGAGCCTGCAGCCAAAAGCTTGAGATGGTATCCATCCATATAAAGGGTTGAAAT
 
. : . : . : . : . : . :
rJMSF022P18- TAGAGGCCAGTGTTCAAACAAGCTTGCTAAATTGATCCTCTCACCAGGGCCAAAAGATTT
rJMSF044J07- TAGAGGCCAGTGTTCAAACAAGCTTGCTAAATTGATCCTCTCACCAGGGCCAAAAGATTT
                      ____________________________________________________________
consensus TAGAGGCCAGTGTTCAAACAAGCTTGCTAAATTGATCCTCTCACCAGGGCCAAAAGATTT
 
. : . : . : . : . : . :
rJMSF022P18- AATTCCATTAGCCAATACAAGGCATGCATTTGTAATACTTTTGCAGTTCATAAAACAATT
rJMSF044J07- AATTCCATTAGCCAATACAAGGCATGCATTTGTAATACTTTTGCAGTTCATAAAACAATT
                      ____________________________________________________________
consensus AATTCCATTAGCCAATACAAGGCATGCATTTGTAATACTTTTGCAGTTCATAAAACAATT
 
. : . : . : . : . : . :
rJMSF022P18- CAGTTTAACCTCGTGATTCTTG
rJMSF044J07- CAGTTTAACCTCGTGATTCTTGGTAAAGTACCAAGGAGGAAAGTGATGATGAACAGCCAT
JMSF044J07+ CGTGATTCTT-GTAAAGTACCAAGGAGGAAAGTGATGATGAACAGCCAT
                      ____________________________________________________________
consensus CAGTTTAACCTCGTGATTCTTGGTAAAGTACCAAGGAGGAAAGTGATGATGAACAGCCAT
 
. : . : . : . : . : . :
rJMSF044J07- CAAAGTTCACGTGATCCATACCACTGCACATTTCTAA
JMSF044J07+ CAAAGTTCACGTGATCCATACCACTGCACATTTCTAAGATCAAACGTTTAAGCTTTGATG
                      ____________________________________________________________
consensus CAAAGTTCACGTGATCCATACCACTGCACATTTCTAAGATCAAACGTTTAAGCTTTGATG
 
. : . : . : . : . : . :
JMFF034I12+ AAAGCAACTTGACTCAAATAAAGCACCT
JMSF044J07+ CAGCAAAGATAGAAGCAGAAACCTCCGGCTTGAAAGCAACTTGACTCAAATAAAGCACCT
JMSF026O15+ AAAGCAACTTTAGTCAAAATAAGCACCT
JMSF023O21+ AAAGCAACTTGACTCAAATAAAGCACCT
JMSF022P18+ AAAGCAACTTGACTCAAATAAAGCACCT
                      ____________________________________________________________
consensus CAGCAAAGATAGAAGCAGAAACCTCCGGCTTGAAAGCAACTTGACTCAAATAAAGCACCT
 
. : . : . : . : . : . :
JMFF034I12+ TAAGATTTTGAAAGCTTCTTATAGTACCACATGGTTGTTTGAAGATACACTTAGACAGAT
JMSF044J07+ TAAGATTTTGAAAGCTTCTTATAGTACCACATGGTTGTTTGAAGATACACTTAGACAGAT
JMSF026O15+ TAAGATTTTGAAAGCTTCTTATAGTACCACATGGTTGTTTGAAGATACAGTTAGACAGAT
JMSF023O21+ TAAGATTTTGAAAGCTTCTTATAGTACCACATGGTTGTTTGAAGATACACTTAGACAGAT
JMSF022P18+ TAAGATTTTGAAAGCTTCTTATAGTACCACATGGTTGTTTGAAGATACCCTTAGACAGAT
                      ____________________________________________________________
consensus TAAGATTTTGAAAGCTTCTTATAGTACCACATGGTTGTTTGAAGATACACTTAGACAGAT
 
. : . : . : . : . : . :
JMFF034I12+ ACAGATACGTAAGTTCTTGACACAAGAATACATAAGAGGGAAGTGCATAGAGATCACGAC
JMSF044J07+ ACAGATACGTAAGTTCTTGACACAAGAATACATAAGAGGGAAGTGCATAGAGATCACGAC
JMSF026O15+ TCAGATACGTAAGTTGTTGACACAAGAATACATAAGAGGGAAGTGCATAGAGATCACGAC
JMSF023O21+ ACAGATACGTAAGTTCTTGACACAAGAATACATAAGAGGGAAGTGCATAGAGATCACGAC
JMSF022P18+ ACAGATACGTAAGTTCTTGACACAAGAATACATAAGAGGGAAGTGCATAGAGATCACGAC
                      ____________________________________________________________
consensus ACAGATACGTAAGTTCTTGACACAAGAATACATAAGAGGGAAGTGCATAGAGATCACGAC
 
. : . : . : . : . : . :
JMFF034I12+ TGGAATTCTTCACTGTGAGTTCCCTCAATCCATTTCTTGACAAGTATAGTATCCATGGAT
JMSF044J07+ TGGAATTCTTCACTGTGAGTTCCCTCAATCCATTTCTTGACAAGTATAGTATCCATGGAT
JMSF026O15+ TGGAATTCTTCAGAGTGAGTTCCCTCAATCCATTTCTTGACAAATATAGTATCCATGGAT
JMSF023O21+ TGGAATTCTTCACTGTGAGTTCCCTCAATCCATTTCTTGACAAGTATAGTATCCATGGAT
JMSF022P18+ TGGAATTCTTCACTGTGAGTTCCCTCAATCCATTTCTTGACAAGTATAGTATCCATGGAT
                      ____________________________________________________________
consensus TGGAATTCTTCACTGTGAGTTCCCTCAATCCATTTCTTGACAAGTATAGTATCCATGGAT
 
. : . : . : . : . : . :
JMFF034I12+ CAATGTTTGGGTACTGTGACATGTGTACATCTGAAAGGTTGACATGAAAAGTTAGAATGG
JMSF044J07+ CAATGTTTGGGTACTGTGACATGTGTACATCTGAAAGGTTGACATGAAAAGTTAGAATGG
JMSF026O15+ CAATGTTTGGGTACTGTGACATGTGTACATCTGAAAGGTTGACACGAAAAGTTAGAATGG
JMSF023O21+ CAATGTTTGGGTACTGTGACATGTGTACATCTGAAAGGTTGACATGAAAAGTTAGAATGG
JMSF022P18+ CAATGTTTGGGTACTGTGACATGTGTACATCTGAAAGGTTGACATGAAAAGTTAGAATGG
                      ____________________________________________________________
consensus CAATGTTTGGGTACTGTGACATGTGTACATCTGAAAGGTTGACATGAAAAGTTAGAATGG
 
. : . : . : . : . : . :
JMFF034I12+ GCCCAATATGCTGTAAGAGAATTTTATTGCCTATTCCAACAAAATCATTTTTGGTGACAG
JMSF044J07+ GCCCAATATGCTGTAAGAGAATTTTATTGCCTATTCCAACAAAATCATTTTTGGTGACAG
JMSF026O15+ GCCCAATATGCTGTAAGAGAATTCGATTGCCTATTCCAACAAAATCATTTTTGGTGACAG
JMSF023O21+ GCCCAATATGCTGTAAGAGAATTTTATTGCCTATTCCAACAAAATCATTTTTGGTGACAG
JMSF022P18+ GCCCAATATGCTGTAAGAGAATTTTATTGCCTATTCCAACAAAATCATTTTTGGTGACAG
                      ____________________________________________________________
consensus GCCCAATATGCTGTAAGAGAATTTTATTGCCTATTCCAACAAAATCATTTTTGGTGACAG
 
. : . : . : . : . : . :
JMFF034I12+ TGACTATATTCTTGGAATCAAGTACAAGATTTGGATGACCAGCCCATATGTATCCCCATT
JMSF044J07+ TGACTATATTCTTGGAATCAAGTACAAGATTTGGATGACCAGCCCATATGTATCTCCATT
JMSF026O15+ TGACTATATTCTTGGGATCAAGTACAAGATTCGGGTGACCAGCCCATATGTATCTCCATT
JMSF023O21+ TGACTATATTCTTGGAATCAAGTACAAGATTTGGATGACCAGCCCATATGTATCTCCATT
JMSF022P18+ TGACTATATTCTTGGAATCAAGTACAAGATTTGGATGACCAGCCCATATGTATCTCCATT
                      ____________________________________________________________
consensus TGACTATATTCTTGGAATCAAGTACAAGATTTGGATGACCAGCCCATATGTATCTCCATT
 
. : . : . : . : . : . :
JMFF034I12+ TTCTAGACAAAACACTTGTTCTTGCTGCATCTCGAGCAGGCAAGCGATCTAGGATGCAAT
JMSF044J07+ TTCTAGACAAAACACTTGTTCTTGCTGCATCTCGAGCAGGCAAGCGATCTAGGATGCAAT
JMSF026O15+ TTCTAGACAAAACACTTGTTCTTGCTGCATCTCGAACAGGCAAGTGATCTAGGATGCAAT
JMSF023O21+ TTCTAGACAAAACACTTGTTCTTGCTGCATCTCGAGCAGGCAAGCGATCTAGGATGCAAT
JMSF022P18+ TTCTAGACAAAACACTTGTTCTTGCTGCATCTCGAGCAGGCAAGCGATCTAGGATGCAAT
                      ____________________________________________________________
consensus TTCTAGACAAAACACTTGTTCTTGCTGCATCTCGAGCAGGCAAGCGATCTAGGATGCAAT
 
. : . : . : . : . : . :
JMFF034I12+ TTAAAACATCCGTTGGCAAGTTAAGAAGTTGATCATCCATAGCCCTCCGTTCGCTATTTC
JMSF044J07+ TTAAAACATCCGTTGGCAAGTTAAGAAGTTGATCATCCATAGCCCTCCGTTCGCTATTTC
JMSF026O15+ GTAAAACATCCGTTGG-AAGTCAATAAATCTATCAATCATGGCCCTCCGTTTGCTATTTC
JMSF023O21+ TTAAAACATCCGTTGGCAAGTTAAGAAGTTGATCATCCATAGCCCTCCGTTCGCTATTTC
JMSF022P18+ TTAAAACATCCGTTGGCAAGTTAAGAAGTTGATCATCCATAGCCCTCCGTTCGCTATTTC
                      ____________________________________________________________
consensus TTAAAACATCCGTTGGCAAGTTAAGAAGTTGATCATCCATAGCCCTCCGTTCGCTATTTC
 
. : . : . : . : . : . :
JMFF034I12+ CTGAGATTTCCTGAGATATCCATTCCTGAACGGAGACGGTCGGATCTTCGACGGAGCACA
JMSF044J07+ CTGAGATTTCCTGAGATATCCATTCCTGAACGGAGACGGTCGGATCTTCGACGGAGCACA
JMSF026O15+ CTGAGATTTCC
JMSF023O21+ CTGAGATTTCCTGAGATATCCATTCCTGAACGGAGACGGTCGGATCTTCGACGGAGCACA
JMSF022P18+ CTGAGATTTCCTGAGATATCCATTCCTGAACGGAGACGGTCGGATCTTCGACGGAGCACA
                      ____________________________________________________________
consensus CTGAGATTTCCTGAGATATCCATTCCTGAACGGAGACGGTCGGATCTTCGACGGAGCACA
 
. : . : . : . : . : . :
JMFF034I12+ AGGCAGGTCCGATTCGACGGAATGTCTTCCACCCTGAATAATCCCTAAAAATCTTCGA
JMSF044J07+ AGGCAGGTCCGATTCGACGGAATGTCTTCCACCCTGAATAATCCCTAAAAATCTTCGA
JMSF023O21+ AGGCAGGTCCGATTCGACGGAATGTCTTCCACCCTGAATAATCCCTAAAAATCTTCGA
JMSF022P18+ AGGCAGGTCCGATTCGACGGAATGTCTTCCACCCTGAATAATCCCTAAAAATCTTCGACC
                      ____________________________________________________________
consensus AGGCAGGTCCGATTCGACGGAATGTCTTCCACCCTGAATAATCCCTAAAAATCTTCGACC