Previous Contig 006106:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS043A05Sequence624006106 (4)gb:AB087840_15247247e-52Pisum sativum sadA mRNA for short-chain alcohol dehydrogenase A, partial cds.
JMSF006I23Sequence329006106 (4)pir|T11579|T115793e-07probable short chain alcohol dehydrogenase CPRD12, drought-inducible - cowpea>gb
JMSF022P01Sequence692006106 (4)gb:AB087840_15247248e-45Pisum sativum sadA mRNA for short-chain alcohol dehydrogenase A, partial cds.750006106 (4)gb:AF053638_17644642e-55Pisum sativum short-chain alcohol dehydrogenase (sadA) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022P01- CCGATCACCGATCGGTACTTCGATTTAATACATAGTTTTTAAAGATATAGGAAAA
                      ____________________________________________________________
consensus CCGATCACCGATCGGTACTTCGATTTAATACATAGTTTTTAAAGATATAGGAAAA
 
. : . : . : . : . : . :
rJMSF022P01- ATAGATTCATTGTAGGCCATCCACTTACTTGTATACAACAAGAAATTGTTATCTCAACTA
                      ____________________________________________________________
consensus ATAGATTCATTGTAGGCCATCCACTTACTTGTATACAACAAGAAATTGTTATCTCAACTA
 
. : . : . : . : . : . :
rJMSF022P01- CTGCCAGGACCAGGGACCGCTAGACAAATCAGACCACCGTCCACCACCAAATCATGGCCG
                      ____________________________________________________________
consensus CTGCCAGGACCAGGGACCGCTAGACAAATCAGACCACCGTCCACCACCAAATCATGGCCG
 
. : . : . : . : . : . :
rJMSF022P01- GTGATAAACGCCGAGTCGTCGGAAGCCAGAAACAGGACAGCGTTAGCCACGTGCTTCACG
                      ____________________________________________________________
consensus GTGATAAACGCCGAGTCGTCGGAAGCCAGAAACAGGACAGCGTTAGCCACGTGCTTCACG
 
. : . : . : . : . : . :
rJMSF022P01- TCCGACGTTATGCCTTTCAGGCTAGTTAGTGGCCCATAAATTTTCTCCACGTAGCTTGAA
                      ____________________________________________________________
consensus TCCGACGTTATGCCTTTCAGGCTAGTTAGTGGCCCATAAATTTTCTCCACGTAGCTTGAA
 
. : . : . : . : . : . :
rJMSF022P01- GCCTTTTCGGGATTGGCAAGAATCATTGGAGTTGGAGTAGCCGACGGCGACACACAATTG
                      ____________________________________________________________
consensus GCCTTTTCGGGATTGGCAAGAATCATTGGAGTTGGAGTAGCCGACGGCGACACACAATTG
 
. : . : . : . : . : . :
rJMSF022P01- ACCCTGATACCGTGGGCCCCCAGTTGCTGGCTAGCCGACCGGACCAACCCAAGAACGGCG
JMFS043A05+ CCGTGGGCCNCCAGTTGCTGGCTCGCCGCCCGGACCAGCCCAAGAACGGCG
                      ____________________________________________________________
consensus ACCCTGATACCGTGGGCCCCCAGTTGCTGGCTCGCCGCCCGGACCAGCCCAAGAACGGCG
 
. : . : . : . : . : . :
rJMSF022P01- TGCTTCGACATGATGTAGTCCGTTCGCCGCACGCCGCCGCGCGTGGCGGCCATGCTTGCC
JMFS043A05+ TGCTTCGACATGACGTAGTCCGTCAGCCGCATGCATCCGCGCGTGGCAGCCGCGCTGGCC
JMSF022P01+ CCGCGCGTGGCGGCCATGCTTGCC
                      ____________________________________________________________
consensus TGCTTCGACATGATGTAGTCCGTTCGCCGCATGCCTCCGCGCGTGGCGGCCATGCTTGCC
 
. : . : . : . : . : . :
rJMSF022P01- GTGCAGATGATGCTCCCCCTCACGCGCCCCTCCACCATTGCACGCGCCGCGTGCTTGACG
JMFS043A05+ GTGCAGATGATGTTCCCCCTCACGCGCCCCTCCACCATCGCACGCGCCGCGTGCTTGACG
JMSF022P01+ GTGCAGATGATGCTCCCCCTCACGCGCCCNTCCACCATTGCACGCGCCGCGTGCTTGACG
                      ____________________________________________________________
consensus GTGCAGATGATGCTCCCCCTCACGCGCCCCTCCACCATTGCACGCGCCGCGTGCTTGACG
 
. : . : . : . : . : . :
rJMSF022P01- CAAACTGCTGTGCCTCGCGCGTTGACACGAAAAACCCGGTCGAAGTGGGAGAAGTCGAGG
JMFS043A05+ CAAACCGCCATGCCTCGCACGTTGATGCGGAAAACCCGGTCGAAGTCGGAGAAGTCGAGG
JMSF022P01+ CAAACTGCTGTGCCTCGCGCGTTGACACGAAAAACCCGGTCGAAGTGGGAGAAGTCGAGG
                      ____________________________________________________________
consensus CAAACTGCTGTGCCTCGCGCGTTGACACGAAAAACCCGGTCGAAGTGGGAGAAGTCGAGG
 
. : . : . : . : . : . :
rJMSF022P01- TCGAGGACCTTCTGGTCGGAGGGGCTCGCCGTGCCGGCATTGCTGAACATGACGTCTAGC
JMFS043A05+ TCGAGGACCTTCTGGGCGGAGCGGCACGGCGTGCCGGCGTTGCTGAACATGACGTCTAGC
JMSF022P01+ TCGAGGACCTTCTGGTCGGAGGGGCTCGCCGTGCCGGCATTGCTGAACATGACGTCTAGC
                      ____________________________________________________________
consensus TCGAGGACCTTCTGGTCGGAGGGGCTCGCCGTGCCGGCATTGCTGAACATGACGTCTAGC
 
. : . : . : . : . : . :
rJMSF022P01- CGGCCGTACTTTTGGACCGTCCAATCTACCATGGCCTTCACTTGCTCCTCGTCGCTAACG
JMFS043A05+ CGGCCGTACTTTTGGACCGTCCAATCTACCATGGCCTTCACTTGCTCCTCGTCGCTAATG
JMSF022P01+ CGGCCGTACTTTTGGACCGTCCAATCTACCATGGCCTTCACTTGCTCCTCGTCGCTAACG
                      ____________________________________________________________
consensus CGGCCGTACTTTTGGACCGTCCAATCTACCATGGCCTTCACTTGCTCCTCGTCGCTAACG
 
. : . : . : . : . : . :
rJMSF022P01- TCGCACTTCACGAAGCTGCACTTCTCGAGGCCGAT
JMFS043A05+ TCGCACTTTACGAAACTGCACTTGTCGAGGCCGATGGCCTCCGCCACGGCGACGCCCTTC
JMSF022P01+ TCGCACTTCACGAAGCTGCACTTCTCGAGGCCGATGGCCTCCGCCACGGCGACGCCCTTC
                      ____________________________________________________________
consensus TCGCACTTCACGAAGCTGCACTTCTCGAGGCCGATGGCCTCCGCCACGGCGACGCCCTTC
 
. : . : . : . : . : . :
JMFS043A05+ TCGTCCTGGATGTCGGCGATGACGACGGCTCGTGTGCCGTGATCAGCAAAAAGCCGAGCT
JMSF006I23+ CGGCAATGACGACGGCTCGTGTGCCGTGATCGGCAAAAAGCCGAGCG
JMSF022P01+ TCGTCCTGGATGTCGGCAATGACGACGGCTCGTGTGCCGTGATCGGCAAAAAGCCGAGCG
                      ____________________________________________________________
consensus TCGTCCTGGATGTCGGCAATGACGACGGCTCGTGTGCCGTGATCGGCAAAAAGCCGAGCG
 
. : . : . : . : . : . :
JMFS043A05+ GTCGCTTCACCGATGCCGCTAGCACCGCCAGTGACTATCACAACTTTGCCTTGGAGCCTT
JMSF006I23+ GTCGCTTCCCCAATGCCGCTAGCACCGCCAGTGACTATCACAACTTTACCTTGGAGCTTT
JMSF022P01+ GTCGCTTCCCCAATGCCGCTAGCACCGCCAGTGACTATCACAACTTTACCTTGGAGCTTT
                      ____________________________________________________________
consensus GTCGCTTCCCCAATGCCGCTAGCACCGCCAGTGACTATCACAACTTTACCTTGGAGCTTT
 
. : . : . : . : . : . :
JMFS043A05+ TTCATGCAAGAATTTGGTGTGCTCATTGCCTCATTCACCTTTGATTCATTCCTGTCTTCC
JMSF006I23+ TTCATGCAAGAATTTGATGTGCCCATTGTCTCATTAACCTTTGATTCATGCCCGTCTTCC
JMSF022P01+ TTCATGCAAGAATTTGATGTGCCCATTGTCTCATTAACCTTTGATTCATGCCCGTCTTCC
                      ____________________________________________________________
consensus TTCATGCAAGAATTTGATGTGCCCATTGTCTCATTAACCTTTGATTCATGCCCGTCTTCC
 
. : . : . : . : . : . :
JMFS043A05+ ATTAC
JMSF006I23+ ATTA-------------CTCTTTGGTCGCCGGTCGGTTTTCAATGGTGGGCGGTCAGGGT
JMSF022P01+ ATTACTACAAAGAAAATCTCTTTGGTCGCCGGTCGGTTTTCAATGGTGGGCGGTCAGGGT
                      ____________________________________________________________
consensus ATTACTACAAAGAAAATCTCTTTGGTCGCCGGTCGGTTTTCAATGGTGGGCGGTCAGGGT
 
. : . : . : . : . : . :
JMSF006I23+ CAGGCTACGGTGGTGAGAAAGGTTCAGGCTACGGTGGCGAGAAGAGGTCAGGCTACCATG
JMSF022P01+ CAGGCTACGGTGGTGAGAAAGGTTCAGGCTACGGTGGCGAGAAGAGGTCAGGCTACGATG
                      ____________________________________________________________
consensus CAGGCTACGGTGGTGAGAAAGGTTCAGGCTACGGTGGCGAGAAGAGGTCAGGCTACGATG
 
. : . : . : . : . : . :
JMSF006I23+ GCGACTGGCAAGACCGCGAGAAGAGGCGGAGGGCGGAGGCTGCGTTTTGATTTC
JMSF022P01+ GCGACTGGCAAGACCGCGAGAAGAGGCGGAGGGCGGAGGCTGCGTTTTGATTTCAGTCCC
                      ____________________________________________________________
consensus GCGACTGGCAAGACCGCGAGAAGAGGCGGAGGGCGGAGGCTGCGTTTTGATTTCAGTCCC