Previous Contig 006094:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044P07Sequence515006094 (11)gb:AB026636_15170632e-15Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY045684_15579006094 (11)pir|D86225|D862253e-17hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889931 Arabid
JMFN004N22Sequence484006094 (11)gb:AP003816_18337683e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMFN041H24Sequence626006094 (11)gb:AB026636_15170633e-14Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY045684_15
JMSF022M08Sequence654006094 (11)gb:AB026636_15170634e-14Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY045684_15787006094 (11)pir|D86225|D862259e-36hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889931 Arabid
JMSF026C17Sequence665006094 (11)gb:AB026636_15170635e-15Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY045684_15814006094 (11)pir|D86225|D862259e-36hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889931 Arabid
JMSF027P12Sequence639006094 (11)gb:AB026636_15170633e-14Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY045684_15735012579 (5)gb:AP001307_18211156e-65Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMM17.
JMSF031C01Sequence642006094 (11)gb:AP003816_18337687e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11693006094 (11)pir|D86225|D862257e-36hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889931 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF044P07- GGTGAATAAACCAATAAATAAGATATTGTTAA
                      ____________________________________________________________
consensus GGTGAATAAACCAATAAATAAGATATTGTTAA
 
. : . : . : . : . : . :
rJMFF044P07- CCACAAATATAAATTTXXXXXXXXXXXXXXXXXXXXXXXXXXXGAAGAAGAAGAAGAAGA
                      ____________________________________________________________
consensus CCACAAATATAAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGAAGAAGAAGAAGA
 
. : . : . : . : . : . :
rJMFF044P07- AGGTAGTGGCTAAAATGGAGGGAATATGGGGAGATCAAACGTGGAAAAGGGATTATGTAT
rJMSF031C01- GTAT
rJMSF026C17- GTAT
                      ____________________________________________________________
consensus AGGTAGTGGCTAAAATGGAGGGAATATGGGGAGATCAAACGTGGAAAAGGGATTATGTAT
 
. : . : . : . : . : . :
rJMFF044P07- ACCATAAAATAAAAGAAAATAAAATAAAAAATACAAGAAAATAAAAGAACTCTCAATTAT
rJMSF031C01- ACAATAAAATAAAAGAAAATAAAATAAAAAATACAAGAAAATAAAAGAACTCTCAATTAT
rJMSF026C17- ACAATAAAATAAAAGAAAATAAAAT-AAAAATACAAGAAAATAAAAGAACTCTCAATTAT
rJMSF022M08- ACAAGAAAATAAAAGAACTCTCAATTAT
                      ____________________________________________________________
consensus ACAATAAAATAAAAGAAAATAAAATAAAAAATACAAGAAAATAAAAGAACTCTCAATTAT
 
. : . : . : . : . : . :
rJMFF044P07- TAACAAAAGATTCTAAAAATATAAAAATAAAAAATATAACACCTCAGCGCAGTCACGAGC
rJMSF031C01- TAACAAAAGATTCTAAAAATATAAAAATAAAAAATATAACACCTCAGCGCAGTCACGAGC
rJMSF026C17- TAACAAAAGATTCTAAAAATATAAAAATAAAAAATATAACACCTCAGCGCAGTCACGAGC
rJMSF022M08- TAACAAAAGATTCTAAAAATATAAAAATAAAAAATATAACACCTCAGCGCAGTCACGAGC
                      ____________________________________________________________
consensus TAACAAAAGATTCTAAAAATATAAAAATAAAAAATATAACACCTCAGCGCAGTCACGAGC
 
. : . : . : . : . : . :
rJMFF044P07- CACTTAGCCAAGGCTTATGACTGTTCTGAGCCAAGCCGGTCGGGATTAGCCGGTAGTCCG
rJMSF031C01- CACTTAGCCAAGGCTTATGACTGTTCTGAGCCAAGCCGGTCGGGATTAGCCGGTAGTCCG
rJMSF026C17- CACTTAGCCAAGGCTTATGACTGTTCTGAGCCAAGCCGGTCGGGATTAGCCGGTAGTCCG
rJMSF022M08- CACTTAGCCAAGGCTTATGACTGTTCTGAGCCAAGCCGGTCGGGATTAGCCGGTAGTCCG
                      ____________________________________________________________
consensus CACTTAGCCAAGGCTTATGACTGTTCTGAGCCAAGCCGGTCGGGATTAGCCGGTAGTCCG
 
. : . : . : . : . : . :
rJMFF044P07- ACTCCGGCACCGTTGAGAAGCCCTGTGAGAACGCTCATGGCTCTAACTTGCATCTCCAGA
rJMSF031C01- ACTCCGGCACCGTTGAGAAGCCCTGTGAGAACGCTCATGGCTCTAACTTGCATCTCCAGA
rJMSF026C17- ACTCCGGCACCGTTGAGAAGCCCTGTGAGAACGCTCATGGCTCTAACTTGCATCTCCAGA
rJMSF022M08- ACTCCGGCACCGTTGAGAAGCCCTGTGAGAACGCTCATGGCTCTAACTTGCATCTCCAGA
                      ____________________________________________________________
consensus ACTCCGGCACCGTTGAGAAGCCCTGTGAGAACGCTCATGGCTCTAACTTGCATCTCCAGA
 
. : . : . : . : . : . :
rJMFF044P07- GCTGCAATATAATCAGTAGCTTCTTCTAGAAGATTCGGGAACGAGAGTTTCCGGCAACCG
rJMSF031C01- GCTGCAATATAATCAGTAGCTTCTTCTAGAAGATTCGGGAACGAGAGTTTCCGGCAACCG
rJMSF026C17- GCTGCAATATAATCAGTAGCTTCTTCTAGAAGATTCGGGAACGAGAGTTTCCGGCAACCG
rJMSF022M08- GCTGCAATATAATCAGTAGCTTCTTCTAGAAGATTCGGGAACGAGAGTTTCCGGCAACCG
                      ____________________________________________________________
consensus GCTGCAATATAATCAGTAGCTTCTTCTAGAAGATTCGGGAACGAGAGTTTCCGGCAACCG
 
. : . : . : . : . : . :
rJMFF044P07- GGAACTAACCGCCCGAGAACTCGGGCCTTCCTTTGCAGCGGCGGCAACCTCTTCTTAGTC
rJMSF031C01- GGAACTAACCGCCCGAGAACTCGGGCCTTCCTTTGCAGCGGCGGCAACCTCTTCTTAGTC
rJMSF026C17- GGAACTAACCGCCCGAGAACTCGGGCCTTCCTTTGCAGCGGCGGCAACCTCTTCTTAGTC
rJMSF022M08- GGAACTAACCGCCCGAGAACTCGGGCCTTCCTTTGCAGCGGCGGCAACCTCTTCTTAGTC
JMFF044P07+ GCAGCGGCGGCAACCTC-TCTTAGTC
JMSF026C17+ TAGTC
                      ____________________________________________________________
consensus GGAACTAACCGCCCGAGAACTCGGGCCTTCCTTTGCAGCGGCGGCAACCTCTTCTTAGTC
 
. : . : . : . : . : . :
rJMFF044P07- GCCGGTTTCTTCGGCCGGATATCGCCGGCGGCTACCACCTTGGCTCTCTTATGCTTTTTG
rJMSF031C01- GCCGGTTTCTTCGGCCGGATATCGCCGGCGGCTACCACCTTGGCTCTCTTATGCTTTTTG
rJMSF026C17- GCCGGTTTCTTCGGCCGGATATCGCCGGCGGCTACCACCTTGGCTCTCTTATGCTTTTTG
rJMSF022M08- GCCGGTTTCTTCGGCCGGATATCGCCGGCGGCTACCACCTTGGCTCTCTTATGCTTTTTG
JMFF044P07+ GCCGG-TTCTTCGGCCGGATATCGCCGGCGGCTACCACCTTGGCTCTCTTATGCTTTTTG
JMFN041H24+ CGGCCGGATATCGCCGGCGGCTACCACCTTGGCTCTCTTATGCTTTTGT
JMSF026C17+ GCCGGTTTCTTCGGCCGGATATCGCCGGCGGCTACCACCTTGGCTCTCTTATGCTTTTTG
JMSF031C01+ ATATCGCCGGCGGCTACCACCTNGGCTCTCTTATGCTTTTTG
JMSF027P12+ TCGCCGGCGGCTACCACCTTGGCTCTCTTATGCTTTTTG
JMSF022M08+ TTCTTCGGCCGGATATCGCCGGCGGCTACCACCTNGGCTCTCTTATGCTTTTTG
                      ____________________________________________________________
consensus GCCGGTTTCTTCGGCCGGATATCGCCGGCGGCTACCACCTTGGCTCTCTTATGCTTTTTG
 
. : . : . : . : . : . :
rJMFF044P07- TTGATCT
rJMSF031C01- TTGATCTGTCTGAGTCTCAAACTAAGCCGTCCGGTGAGAATCGCTCTGCTCCAGCGTGTC
rJMSF026C17- TTGATCTGTCTGAGTCTCAAACTAAGCCGTCCGGTGAGAATCGCTCTGCTCCAGCGTGTC
rJMSF022M08- TTGATCTGTCTGAGTCTCAAACTAAGCCGTCCGGTGAGAATCGCTCTGCTCCAGCGTGTC
JMFF044P07+ TTGATCTGTCTGAGTCTCAAACTAAGCCGTCCGGTGAGAATCGCTCTGCTCCAGCGTGTC
JMFN004N22+ AAGCCGTCCGGTGAGAATCGCTCTGCTCCAGCGTGTC
JMFN041H24+ GATTTCTGTCTGAGTCTCAAACTAAGCCGTCCGGTGAGAATCGCTCTGCTCCAGCGTGTC
JMSF026C17+ TTGATCTGTCTGAGTCTCAAACTAAGCCGTCCGGTGAGAATCGCTCTGCTCCAGCGTGTC
JMSF031C01+ TTGATCTGTCTGAGTCTCAAACTAAGCCGTCCGGTGAGAATCGCTCTGCTCCAGCGTGTC
JMSF027P12+ TTGATCTGTCTGAGTCTCAAACTAAGCCGTCCGGTGAGAATCGCTCTGCTCCAGCGTGTC
JMSF022M08+ TTGATCTGTCTGAGTCTCAAACTAAGCCGTCCGGTGAGAATCGCTCTGCTCCAGCGTGTC
                      ____________________________________________________________
consensus TTGATCTGTCTGAGTCTCAAACTAAGCCGTCCGGTGAGAATCGCTCTGCTCCAGCGTGTC
 
. : . : . : . : . : . :
rJMSF031C01- TTCCCCTTGGCGGCGACGGCGAGGACCTTGTCCGCAGTCTCCCGAACAGTGCGGCCAGCA
rJMSF026C17- TTCCCCTTGGCGGCGACGGCGAGGACCTTGTCCGCAGTCTCCCGAACAGTGCGGCCAGCA
rJMSF022M08- TTCCCCTTGGCGGCGACGGCGAGGACCTTGTCCGCAGTCTCCCGAACAGTGCGGCCAGCA
JMFF044P07+ TTCCCCTTGGCGGCGACGGCGAGGACCTTGTCCGCAGTCTCCCGAACAGTGCGGCCAGCA
JMFN004N22+ TTCCCCTTGGCGGCGACGGCGAGGACCTTGTCCGCAGTCTCCCGAACAGTGCGGCCAGCA
JMFN041H24+ TTCCCCTTGGCGGCGACGGCGAGGACCTTGTCCGCAGTCTCCCGAACAGTGCGGCCAGCA
JMSF026C17+ TTCCCCTTGGCGGCGACGGCGAGGACCTTGTCCGCAGTCTCCCGAACAGTGCGGCCAGCA
JMSF031C01+ TTCCCCTTGGCGGCGACGGCGAGGACCTTGTCCGCAGTCTCCCGAACAGTGCGGCCAGCA
JMSF027P12+ TTCCCCTTGGCGGCGACGGCGAGGACCTTGTCCGCAGTCTCCCGAACAGTGCGGCCAGCA
JMSF022M08+ TTCCCCTTGGCGGCGACGGCGAGGACCTTGTCCGCAGTCTCCCGAACAGTGCGGCCAGCA
                      ____________________________________________________________
consensus TTCCCCTTGGCGGCGACGGCGAGGACCTTGTCCGCAGTCTCCCGAACAGTGCGGCCAGCA
 
. : . : . : . : . : . :
rJMSF031C01- ACAGCGGGAGATGGCGCCTCATTTCTCCGGCGGACCTGACGGAGGGCCTCCAGAAGCTTC
rJMSF026C17- ACAGCGGGAGATGGCGCCTCATTTCTCCGGCGGACCTGACGGAGGGCCTCCAGAAGCTTC
rJMSF022M08- ACAGCGGGAGATGGCGCCTCATTTCTCCGGCGGACCTGACGGAGGGCCTCCAGAAGCTTC
JMFF044P07+ ACAGCGGGAGATGGCGCCTCATTTCTCCGGCGGACCTGACGGAGGGCCTCCAGAAGCTTC
JMFN004N22+ ACAGCGGGAGATGGCGCCTCATTTCTCCGGCGGACCTGACGGAGGGCCTCCAGAAGCTTC
JMFN041H24+ ACAGCGGGAGATGGCGCCTCATTTCTCCGGCGGACCTGACGGAGGGCCTCCAGAAGCTTC
JMSF026C17+ ACAGCGGGAGATGGCGCCTCATTTCTCCGGCGGACCTGACGGAGGGCCTCCAGAAGCTTC
JMSF031C01+ ACAGCGGGAGATGGCGCCTCATTTCTCCGGCGGACCTGACGGAGGGCCTCCAGAAGCTTC
JMSF027P12+ ACAGCGGGAGATGGCGCCTCATTTCTCCGGCGGACCTGACGGAGGGCCTCCAGAAGCTTC
JMSF022M08+ ACAGCGGGAGATGGCGCCTCATTTCTCCGGCGGACCTGACGGAGGGCCTCCAGAAGCTTC
                      ____________________________________________________________
consensus ACAGCGGGAGATGGCGCCTCATTTCTCCGGCGGACCTGACGGAGGGCCTCCAGAAGCTTC
 
. : . : . : . : . : . :
rJMSF031C01- GACGAGTAGATCTGCTGCTCGTCCTGGGTCCTCCACCTGAGTACATCGACGCCGGTAGGT
rJMSF026C17- GACGAGTAGATCTGCTGCTCGTCCTGGGTCCTCCACCTGAGTACATCGACGCCGGTAGGT
rJMSF022M08- GACGAGTAGATCTGCTGCTCGTCCTGGGTCCTCCACCTGAGTACATCGACGCCGGTAGGT
JMFF044P07+ GACGAGTAGATCTGCTGCTCGTCCTGGGTCCTCCACCTGAGTACATCGACGCCGGTAGGT
JMFN004N22+ GACGAGTAGATCTGCTGCTCGTCCTGGGTCCTCCACCTGAGTACATCGACGCCGGTAGGT
JMFN041H24+ GACGAGTAGATCTGCTGCTCGTCCTGGGTCCTCCACCTGAGTACATCGACGCCGGTAGGT
JMSF026C17+ GACGAGTAGATCTGCTGCTCGTCCTGGGTCCTCCACCTGAGTACATCGACGCCGGTAGGT
JMSF031C01+ GACGAGTAGATCTGCTGCTCGTCCTGGGTCCTCCACCTGAGTACATCGACGCCGGTAGGT
JMSF027P12+ GACGAGTAGATCTGCTGCTCGTCCTGGGTCCTCCACCTGAGTACATCGACGCCGGTAGGT
JMSF022M08+ GACGAGTAGATCTGCTGCTCGTCCTGGGTCCTCCACCTGAGTACATCGACGCCGGTAGGT
                      ____________________________________________________________
consensus GACGAGTAGATCTGCTGCTCGTCCTGGGTCCTCCACCTGAGTACATCGACGCCGGTAGGT
 
. : . : . : . : . : . :
rJMSF031C01- TGCGGCTGATTCTGGTCAGA
rJMSF026C17- TGCGGCTGATTCTGGTCAGACTCGCCGATTTTTCTCCGCTTTTTCCGCGATCGGTTGGAG
rJMSF022M08- TGCGGCTGATTCTGGTCAGACTCGCCGATTTTTCTCCGCTTTTTCCGCGATCGGTTGGAG
JMFF044P07+ TGCGGCTGATTCTGGTCAGACTCGCCGATTTTTCTCCGCTTTTTCCGCGATCGGTTGGAG
JMFN004N22+ TGCGGCTGATTCTGGTCAGACTCGCCGATTTTTCTCCGCTTTTTCCGCGATCGGTTGGAG
JMFN041H24+ TGCGGCTGATTCTGGTCAGACTCGCCGATTTTTCTCCGCTTTTTCCGCGATCGGTTGGAG
JMSF026C17+ TGCGGCTGATTCTGGTCAGACTCGCCGATTTTTCTCCGCTTTTTCCGCGATCGGTTGGAG
JMSF031C01+ TGCGGCTGATTCTGGTCAGACTCGCCGATTTTTCTCCGCTTTTTCCGCGATCGGTTGGAG
JMSF027P12+ TGCGGCTGATTCTGGTCAGACTCGCCGATTTTTCTCCGCTTTTTCCGCGATCGGTTGGAG
JMSF022M08+ TGCGGCTGATTCTGGTCAGACTCGCCGATTTTTCTCCGCTTTTTCCGCGATCGGTTGGAG
                      ____________________________________________________________
consensus TGCGGCTGATTCTGGTCAGACTCGCCGATTTTTCTCCGCTTTTTCCGCGATCGGTTGGAG
 
. : . : . : . : . : . :
rJMSF026C17- TTGACATCGGGATTCGCTATCGAAGACGATAACTCCATCATTCTATCAATCAGTCAAGTT
rJMSF022M08- TTGACATCGGGATTCGCTATCGAAGACGATAACTCCATCATTCTATCAATCAGTCANGTT
JMFF044P07+ TTGACATCGGGATTCGCTATCGAAGACGATAACTCCATCATTCTATCAATCAGTCAAGTT
JMFN004N22+ TTGACATCGGGATTCGCTATCGAAGACGATAACTCGATCATTCTATCAATCAGTCAAGTT
JMFN041H24+ TTGACATCGGGATTCGCTATCGAAGACGATAACTCCATCATTCTATCAATCAGTCAAGTT
JMSF026C17+ TTGACATCGGGATTCGCTATCGAAGACGATAACTCCATCATTCTATCAATCAGTCAAGTT
JMSF031C01+ TTGACATCGGGATTCGCTATCGAAGACGATAACTCCATCATTCTATCAATCAGTCAAGTT
JMSF027P12+ TTGACATCGGGATTCGCTATCGAAGACGATAACTCCATCATTCTATCAATCAGTCAAGTT
JMSF022M08+ TTGACATCGGGATTCGCTATCGAAGACGATAACTCCATCATTCTATCAATCAGTCAAGTT
                      ____________________________________________________________
consensus TTGACATCGGGATTCGCTATCGAAGACGATAACTCCATCATTCTATCAATCAGTCAAGTT
 
. : . : . : . : . : . :
rJMSF026C17- TATATGCACAGTACTCTGCCTCT
rJMSF022M08- TATATGCACAGTACTCTGCCTCTCTTCGTGGTATTGCAG
JMFF044P07+ TATATGCACAGTACTCTGCCTCTCTTCGTGGTATTGCAGGTTGAGAGAAGGATATATTGA
JMFN004N22+ TATATGCACAGTACTCTGCCTCTCTTCGTGGTATTGCAGGTTGAGAGAAGGATATATTGA
JMFN041H24+ TATATGCACAGTACTCTGCCTCTCTTCGTGGTATTGCAGGTTGAGAGAAGGATATATTGA
JMSF026C17+ TATATGCACAGTACTCTGCCTCTCTTCGTGGTATTGCAGGTTGAGAGAAGGATATATTGA
JMSF031C01+ TATATGCACAGTACTCTGCCTCTCTTCGTGGTATTGCAGGTTGAGAGAAGGATATATTGA
JMSF027P12+ TATATGCACAGTACTCTGCCTCTCTTCGTGGTATTGCAGGTTGAGAGAAGGATATATTGA
JMSF022M08+ TATATGCACAGTACTCTGCCTCTCTTCGTGGTATTGCAGGTTGAGAGAAGGATATATTGA
                      ____________________________________________________________
consensus TATATGCACAGTACTCTGCCTCTCTTCGTGGTATTGCAGGTTGAGAGAAGGATATATTGA
 
. : . : . : . : . : . :
JMFF044P07+ AGATTCAAATG
JMFN004N22+ AGATTCAAATGCTCCTTGCTTTGTTTACTCCGGCAGCGGCGGAATAGGTGGTGGCTGCGC
JMFN041H24+ AGATTCAAATGCTCCTTGCTTTGTTTACTCCGGCAGCGGCGGAATAGGTGGTGGCTGCGC
JMSF026C17+ AGATTCAAATGCTCCTTGCTTTGTTTACTCCGGCAGCGGCGGAATAGGTGGTGGCTGCGC
JMSF031C01+ AGATTCAAATGCTCCTTGCTTTGTTTACTCCGGCAGCGGCGGAATAGGTGGTGGCTGCGC
JMSF027P12+ AGATTCAAATGCTCCTTGCTTTGTTTACTCCGGCAGCGGCGGAATAGGTGGTGGCTGCGC
JMSF022M08+ AGATTCAAATGCTCCTTGCTTTGTTTACTCCGGCAGCGGCGGAATAGGTGGTGGCTGCGC
                      ____________________________________________________________
consensus AGATTCAAATGCTCCTTGCTTTGTTTACTCCGGCAGCGGCGGAATAGGTGGTGGCTGCGC
 
. : . : . : . : . : . :
JMFN004N22+ CGGTTGCGAATTGAGTAAAGGAAGGCT
JMFN041H24+ CGGTTGCGAATTGAGTAAAGGAAGGCTTGAACTGAAGAGAGAGAGAATGAGAGAGAGAGA
JMSF026C17+ CGGTTGCGAATTGAGTAAAGGAAGGCTTGAACTGAAGAGAGAGAGAATGAGAGAGAGAGA
JMSF031C01+ CGGTTGCGAATTGAGTAAAGGAAGGCTTGAACTGAAGAGAGAGAGAATGAGAGAGAGAGA
JMSF027P12+ CGGTTGCGAATTGAGTAAAGGAAGGCTTGAACTGAAGAGAGAGAGAATGAGAGAGAGAGA
JMSF022M08+ CGGTTGCGAATTGAGTAAAGGAAGGCTTGAACTGAAGAGAGAGAGAATGAGAGAGAGAGA
                      ____________________________________________________________
consensus CGGTTGCGAATTGAGTAAAGGAAGGCTTGAACTGAAGAGAGAGAGAATGAGAGAGAGAGA
 
. : . : . : . : . : . :
JMFN041H24+ GACGAATGGTGCGTTTTTGTAGTGGAAAAGAGGAGAG
JMSF026C17+ GACGAATGGTGCGTTTTTGTAGTGGAAAAGAGGAGAGAGGGAGAGATAGAGAGAACAACC
JMSF031C01+ GACGAATGGTGCGTTTTTGTAGTGGAAAAGAGGAGAGAGGGAGAGATAGAGAGAAGAACC
JMSF027P12+ GACGAATGGTGCGTTTTTGTAGTGGAAAAGAGGAGAGAGGGAGAGATAGAGAGAAGAACC
JMSF022M08+ GACGAATGGTGCGTTTTTGTAGTGGAAAAGAGGAGAGAGGGAGAGATAGAGAGAAGAACC
                      ____________________________________________________________
consensus GACGAATGGTGCGTTTTTGTAGTGGAAAAGAGGAGAGAGGGAGAGATAGAGAGAAGAACC