Previous Contig 006090:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015F10Sequence586006090 (16)pir|T05790|T057902e-63hypothetical protein M7J2.60 - Arabidopsis thaliana>gb:ATM7J2_1553682 Arabidopsi724006090 (16)gb:AY085603_15706712e-70Arabidopsis thaliana clone 15975 mRNA, complete sequence.
JMFF016G12Sequence562006090 (16)pir|E85295|E852952e-71hypothetical protein AT4g25570 [imported] - Arabidopsis thaliana>gb:ATCHRIV63_15
JMFF019N03Sequence582006090 (16)pir|T05790|T057905e-65hypothetical protein M7J2.60 - Arabidopsis thaliana>gb:ATM7J2_1553682 Arabidopsi735006090 (16)gb:AY085603_15706713e-71Arabidopsis thaliana clone 15975 mRNA, complete sequence.
JMFF019O23Sequence624006090 (16)pir|T05790|T057904e-81hypothetical protein M7J2.60 - Arabidopsis thaliana>gb:ATM7J2_1553682 Arabidopsi727006090 (16)gb:AY085603_15706716e-71Arabidopsis thaliana clone 15975 mRNA, complete sequence.
JMFN008G09Sequence619006090 (16)pir|T05790|T057904e-73hypothetical protein M7J2.60 - Arabidopsis thaliana>gb:ATM7J2_1553682 Arabidopsi
JMSF019I01Sequence452006090 (16)pir|T05790|T057903e-43hypothetical protein M7J2.60 - Arabidopsis thaliana>gb:ATM7J2_1553682 Arabidopsi752006090 (16)gb:AY085603_15706712e-78Arabidopsis thaliana clone 15975 mRNA, complete sequence.
JMSF022L23Sequence669006090 (16)pir|T05790|T057901e-75hypothetical protein M7J2.60 - Arabidopsis thaliana>gb:ATM7J2_1553682 Arabidopsi708006090 (16)gb:AY085603_15706713e-73Arabidopsis thaliana clone 15975 mRNA, complete sequence.
JMSF026E05Sequence662006090 (16)pir|T05790|T057901e-75hypothetical protein M7J2.60 - Arabidopsis thaliana>gb:ATM7J2_1553682 Arabidopsi774006090 (16)gb:AY085603_15706717e-83Arabidopsis thaliana clone 15975 mRNA, complete sequence.
JMSF035B04Sequence669006090 (16)pir|T05790|T057901e-75hypothetical protein M7J2.60 - Arabidopsis thaliana>gb:ATM7J2_1553682 Arabidopsi688006090 (16)gb:AY085603_15706718e-67Arabidopsis thaliana clone 15975 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF015F10- TATATAAACCAC
rJMFF019O23- TATATAAACCAC
rJMFF019N03- CATATATAAACCAC
                      ____________________________________________________________
consensus CATATATAAACCAC
 
. : . : . : . : . : . :
rJMSF035B04- ACATACATATAATAACCTGAGAAATACACTGGAG-TTGTGTTACACAAC-
rJMFF015F10- ATGTTTTTCAACATACATATAATAACCTGAGAAATACACT-GAG-TTGTGTTACACAAC-
rJMFF019O23- ATGTTTTTCAACATACATATAATAACCTGAGAAATACACT-GAG-TTGTGTTACACAAC-
rJMFF019N03- ATGTTTTTCAACATACATATAATAACCTGAGAAATACACT-GAG-TTGTGTTACACAAC-
rJMSF022L23- ATATAATAACCTGAGAAATACACT-GAG-TTGTGTTACACAAC-
rJMSF019I01- ACATACATATAATAACCTGAGAAATACACTGGAGTTTGTGTTACACAACT
rJMSF026E05- ACATACATATAATAACCTGAGAAATACACT-GAG-TTGTGTTACACAAC-
                      ____________________________________________________________
consensus ATGTTTTTCAACATACATATAATAACCTGAGAAATACACT-GAG-TTGTGTTACACAAC-
 
. : . : . : . : . : . :
rJMSF035B04- TACTTGAAGAACAAAGAAAGCTTTAAGTCCAGCCTGCTTGTATTATAATTTATAACACAA
rJMFF015F10- TACTTGAAGAACAAAGAAAGCTTTAAGTCCAGCCTGCTTGTATTATAATTTATAACACAA
rJMFF019O23- TACTTGAAGAACAAAGAAAGCTTTAAGTCCAGCCTGCTTGTATTATAATTTATAACACAA
rJMFF019N03- TACTTGAAGAACAAAGAAAGCTTTAAGTCCAGCCTGCTTGTATTATAATTTATAACACAA
rJMSF022L23- TACTTGAAGAACAAAGAAAGCTTTAAGTCCAGCCTGCTTGTATTATAATTTATAACACAA
rJMSF019I01- TACTTGAAGAACAAAGAAAGCTTTAAGTCCAGCCTGCTTGTATTATAATTTATAACACAA
rJMSF026E05- TACTTGAAGAACACAGATAGCTTTAAGTCCAGCCTACTTGTATTATAATTTATAACACAA
                      ____________________________________________________________
consensus TACTTGAAGAACAAAGAAAGCTTTAAGTCCAGCCTGCTTGTATTATAATTTATAACACAA
 
. : . : . : . : . : . :
rJMSF035B04- AGGGGGAATAGGGATCTGTCTATGTCCACAGGTAGAATGATAGTGGATATATGCCATCAT
rJMFF015F10- AGGGGGAATAGGGATCTGTCTATGTCCACAGGTAGAATGATAGTGGATATATGCCATCAT
rJMFF019O23- AGGGGGAATAGGGATCTGTCTATGTCCACAGGTAGAATGATAGTGGATATATGCCATCAT
rJMFF019N03- AGGGGGAATAGGGATCTGTCTATGTCCACAGGTAGAATGATAGTGGATATATGCCATCAT
rJMSF022L23- AGGGGGAATAGGGATCTGTCTATGTCCACAGGTAGAATGATAGTGGATATATGCCATCAT
rJMSF019I01- AGGGGGAATAGGGATCTGTCTATGTCCACAGGTAGAATGATAGTGGATATATGCCATCAT
rJMSF026E05- AGGGGGAATAGGGATCTGTCTATGTCCACAGGTAGAATGATAGTGGATATATGCCATCAT
                      ____________________________________________________________
consensus AGGGGGAATAGGGATCTGTCTATGTCCACAGGTAGAATGATAGTGGATATATGCCATCAT
 
. : . : . : . : . : . :
rJMSF035B04- ATTGCAGAGTAACTGTGATCATCCTCGGTGGGAGCCTGAGAAAGGATCGTCAAGAACACA
rJMFF015F10- ATTGCAGAGTAACTGTGATCATCCTCGGTGGGAGCCTGAGAAAGGATCGTCAAGAACACA
rJMFF019O23- ATTGCAGAGTAACTGTGATCATCCTCGGTGGGAGCCTGAGAAAGGATCGTCAAGAACACA
rJMFF019N03- ATTGCAGAGTAACTGTGATCATCCTCGGTGGGAGCCTGAGAAAGGATCGTCAAGAACACA
rJMSF022L23- ATTGCAGAGTAACTGTGATCATCCTCGGTGGGAGCCTGAGAAAGGATCGTCAAGAACACA
JMFF016G12+ GAGAAAGGATCGTCAAGAACACA
rJMSF019I01- ATTGCAGAGTAACTGTGATCATCCTCGGTGGGAGCCTGAGAAAGGATCGTCAAGAACACA
rJMSF026E05- ATTGCAGAGTAACTGTGATCATCCTCAGTGGGAGCCTGAGAAAGGGTCGTCAAGAACACA
                      ____________________________________________________________
consensus ATTGCAGAGTAACTGTGATCATCCTCGGTGGGAGCCTGAGAAAGGATCGTCAAGAACACA
 
. : . : . : . : . : . :
rJMSF035B04- AAGACTCCATATATAACCGTAGAAATAGCAGTGAAGTTGACAAGAAAGGCCTCAGACCCA
rJMFF015F10- AAGACTCCATATATAACCGTAGAAATAGCAGTGAAGTTGACAAGAAAGGCCTCAGACCCA
rJMFF019O23- AAGACTCCATATATAACCGTAGAAATAGCAGTGAAGTTGACAAGAAAGGCCTCAGACCCA
rJMFF019N03- GAGACTCCATATATAACCGTAGAAATAGCAGTGAAGTTGACAAGAAAGGCCTCAGACCCA
rJMSF022L23- AAGACTCCATATATAACCGTAGAAATAGCAGTGAAGTTGACAAGAAAGGCCTCAGACCCA
JMFF016G12+ AAGACTCCATATATAACCGTAGAAATAGCAGTGAAGTTGACAAGAAAGGCCTCAGACCCA
rJMSF019I01- AAGACTCCATATATAACCGTAGAAATAGCAGTGAAGTTGACAAGAAAGGCCTCAGACCCA
rJMSF026E05- AAGACTCCATATATAACCGTAGAAATAGCAGTGAAGTTGACAAGAAAGGCCTCAGATCCA
JMFF019O23+ GTAGAAATAGCAGTGAAGTTGACAAGAAAGGCCTCAGACCCA
JMSF035B04+ TCAGACCCA
JMSF026E05+ TCAGATCCA
JMSF022L23+ TCAGACCCA
                      ____________________________________________________________
consensus AAGACTCCATATATAACCGTAGAAATAGCAGTGAAGTTGACAAGAAAGGCCTCAGACCCA
 
. : . : . : . : . : . :
rJMSF035B04- TATTTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAACAAGGCG
rJMFF015F10- TATTTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAACAAGGCG
rJMFF019O23- TATTTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAACAAGGCG
rJMFF019N03- TATTTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAGCAAGGCG
rJMSF022L23- TATTTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAACAAGGCG
JMFF016G12+ TATTTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAACAAGGCG
rJMSF019I01- TATTTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAACAAGGCG
rJMSF026E05- TATTTGTCCAGGCCAGAGCTCTCGAGGAACGTGAGCTTCTCGAGGAATCCTAGCAAGGCG
JMFF019O23+ TATTTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAACAAGGCG
JMSF035B04+ TATTTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAACAAGGCG
JMSF026E05+ TATTTGTCCAGGCCAGAGCTCTCGAGGAACGTGAGCTTCTCGAGGAATCCTAGCAAGGCG
JMFN008G09+ TTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAACAAGGCG
JMFF019N03+ AGCAAGGCG
JMSF022L23+ TATTTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAACAAGGCG
                      ____________________________________________________________
consensus TATTTGTCCAGGCCAGAGCTCTCAAGGAACGTGAGCTTCTCGAGGAATCCTAACAAGGCG
 
. : . : . : . : . : . :
rJMSF035B04- TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
rJMFF015F10- TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
rJMFF019O23- TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
rJMFF019N03- TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
rJMSF022L23- TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
JMFF016G12+ TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
rJMSF019I01- TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
rJMSF026E05- TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGATTCG
JMFF019O23+ TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
JMSF035B04+ TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
JMSF026E05+ TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGATTCG
JMFN008G09+ TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
JMFF015F10+ ACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
JMFF019N03+ TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
JMSF022L23+ TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
                      ____________________________________________________________
consensus TTGGCAACAGCTAAAATGTACACAAACGTGCCAAAGAGCACGTGCCAAGGAAGTGACTCG
 
. : . : . : . : . : . :
rJMSF035B04- CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
rJMFF015F10- CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
rJMFF019O23- CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
rJMFF019N03- CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
rJMSF022L23- CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
JMFF016G12+ CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
rJMSF019I01- CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
rJMSF026E05- CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
JMFF019O23+ CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
JMSF035B04+ CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
JMSF026E05+ CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
JMFN008G09+ CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
JMFF015F10+ CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
JMFF019N03+ CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
JMSF022L23+ CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
                      ____________________________________________________________
consensus CGTCTGATATCTGCTGTTCCACCCGGGTAGAAGAACACCACAAAGCCATAAACCCACTGA
 
. : . : . : . : . : . :
rJMSF035B04- ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
rJMFF015F10- ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
rJMFF019O23- ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
rJMFF019N03- ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
rJMSF022L23- ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
JMFF016G12+ ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
rJMSF019I01- ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
rJMSF026E05- ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
JMFF019O23+ ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
JMSF035B04+ ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
JMSF026E05+ ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
JMFN008G09+ ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
JMFF015F10+ ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
JMFF019N03+ ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
JMSF019I01+ TCCAATCCAGGAATGTAAACTGTACAAATNGGCA
JMSF022L23+ ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
                      ____________________________________________________________
consensus ATGCCATAAAGAACAGCAACCCCAATTCCAATCCAGGAATGTAAACTGTACAAATTGGCA
 
. : . : . : . : . : . :
rJMSF035B04- ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
rJMFF015F10- ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
rJMFF019O23- ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
rJMFF019N03- ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
rJMSF022L23- ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
JMFF016G12+ ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
rJMSF019I01- ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
rJMSF026E05- ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
JMFF019O23+ ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
JMSF035B04+ ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
JMSF026E05+ ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
JMFN008G09+ ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
JMFF015F10+ ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
JMFF019N03+ ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
JMSF019I01+ ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
JMSF022L23+ ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
                      ____________________________________________________________
consensus ATGCCACTTTCATTGTGATTCTTAAATGCTGCGCATATTCCCACGATACCAAGCACCAAG
 
. : . : . : . : . : . :
rJMSF035B04- GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
rJMFF015F10- GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
rJMFF019O23- GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
rJMFF019N03- GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
rJMSF022L23- GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
JMFF016G12+ GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
rJMSF019I01- GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
rJMSF026E05- GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
JMFF019O23+ GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
JMSF035B04+ GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
JMSF026E05+ GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
JMFN008G09+ GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
JMFF015F10+ GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
JMFF019N03+ GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
JMSF019I01+ GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
JMSF022L23+ GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
                      ____________________________________________________________
consensus GCAATGGCATGCAACACCAGATGGATCACTTTCTTCACTTCTTTCTTCAATGGGAGCGAT
 
. : . : . : . : . : . :
rJMSF035B04- TTATAGCTCATAATAGCTTCTCCTCCAAGAATA
rJMFF015F10- TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAA
rJMFF019O23- TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAG
rJMFF019N03- TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCNATAAGCATTAAAACAGGG
rJMSF022L23- TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAGGG
JMFF016G12+ TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAGGG
rJMSF019I01- TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAGGG
rJMSF026E05- TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCNATAAGCATTAGAACAGGG
JMFF019O23+ TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAGGG
JMSF035B04+ TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAGGG
JMSF026E05+ TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAGAACAGGG
JMFN008G09+ TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAGGG
JMFF015F10+ TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAGGG
JMFF019N03+ TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAGGG
JMSF019I01+ TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAGGG
JMSF022L23+ TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAGGG
                      ____________________________________________________________
consensus TTATAGCTCATAATAGCTTCTCCTCCAAGAATAACGAAGCCAATAAGCATTAAAACAGGG
 
. : . : . : . : . : . :
rJMFF019N03- TGAA
rJMSF022L23- TGAAGGT
JMFF016G12+ TGAAG
rJMSF019I01- TGAAGGTTAAAGATGAGATTTTTGTTGGTATCTTCCC
rJMSF026E05- TGAAGGTTAAAGATGAGATTTTTGTTGGTATCTTCCCAAGCCAATCCACCCCTGAAGTGA
JMFF019O23+ TGAAGGTTAAAGATGAGATTTTTGTTGGTATCTTCCCAAGCCAATCCACCCCTGAAGTGA
JMSF035B04+ TGAAGGTTAAAGATGAGATTTTTGTTGGTATCTTCCCAAGCCAATCCACCCCTGAAGTGA
JMSF026E05+ TGAAGGTTAAAGATGAGATTTTTGTTGGTATCTTCCCAAGCCAATCCACCCCTGAAGTGA
JMFN008G09+ TGAAGGTTAAAGATGAGATTTTTGTTGGTATCTTCCCAAGCCAATCCACCCCTGAAGTGA
JMFF015F10+ TGAAGGTTAAAGATGAGATTTTTGTTGGTATCTTCCCAAGCCAATCCACCCCTGAAGTGA
JMFF019N03+ TGAAGGTTAAAGATGAGATTTTTGTTGGTATCTTCCCAAGCCAATCCACCCCTGAAGTGA
JMSF019I01+ TGAAGGTTAAAGATGAGATTTTTGTTGGTATCTTCCCAAGCCAATCCACCCCTGAAGTGA
JMSF022L23+ TGAAGGTTAAAGATGAGATTTTTGTTGGTATCTTCCCAAGCCAATCCACCCCTGAAGTGA
                      ____________________________________________________________
consensus TGAAGGTTAAAGATGAGATTTTTGTTGGTATCTTCCCAAGCCAATCCACCCCTGAAGTGA
 
. : . : . : . : . : . :
rJMSF026E05- ATGTTCC
JMFF019O23+ ATGTTCCATACCAAAACCAGCACCGCTAATACTAGAGCAATTGCGTGTGCCACGCACGAG
JMSF035B04+ ATGTTCCATACCAAAACCAGCACCGCTAATACTAGAGCAATTGCGTGTGCCACGCACGAG
JMSF026E05+ ATGTTCCATACCAAAACCAGCACCGCTAATACTAGAGCAATTGCGTGTGCCACGCACGAG
JMFN008G09+ ATGTTCCATACCAAAACCAGCACCGCTAATACTAGAGCAATTGCGTGTGCCACGCACGAG
JMFF015F10+ ATGTTCCATACCAAAACCAGCACCGCTAATACTAGAGCAATTGCGTGTGCCACGCACGAG
JMFF019N03+ ATGTTCCATACCAAAACCAGCACCGCTAATACTAGAGCAATTGCGTGTGCCACGCACGAG
JMSF019I01+ ATGTTCCATACCAAAACCAGCACCGCTAATACTAGAGCAATTGCGTGTGCCACGCACGAG
JMSF022L23+ ATGTTCCATACCAAAACCAGCACCGCTAATACTAGAGCAATTGCGTGTGCCACGCACGAG
                      ____________________________________________________________
consensus ATGTTCCATACCAAAACCAGCACCGCTAATACTAGAGCAATTGCGTGTGCCACGCACGAG
 
. : . : . : . : . : . :
JMFF019O23+ AAAGGCAAGGCCTTTGCGGCTATCGCCATGTCTCTTTCCTTC
JMSF035B04+ AAAGGCAAGGCCTTTGCGGCTATCGCCATGTCTCTTTCCTTCAACTCTTCACAGTACACT
JMSF026E05+ AAAGGCAAGGCCTTTGCGGCTATCGCCATGTCTCTTTCCTTCAACTCTTCACAGTACACT
JMFN008G09+ AAAGGCAAGGCCTTTGCGGCTATCGCCATGTCTCTTTCCTTCAACTCTTCACAGTACACT
JMFF015F10+ AAAGGCAAGGCCTTTGCGGCTATCGCCATGTCTCTTTCCTTCAACTCTTCACAGTACACT
JMFF019N03+ AAAGGCAAGGCCTTTGCGGCTATCGCCATGTCTCTTTCCTTCAACTCTTCACAGTACACT
JMSF019I01+ AAAGGCAAGGCCTTTGCGGCTATCGCCATGTCTCTTTCCTTCAACTCTTCACAGTACACT
JMSF022L23+ AAAGGCAAGGCCTTTGCGGCTATCGCCATGTCTCTTTCCTTCAACTCTTCACAGTACACT
                      ____________________________________________________________
consensus AAAGGCAAGGCCTTTGCGGCTATCGCCATGTCTCTTTCCTTCAACTCTTCACAGTACACT
 
. : . : . : . : . : . :
JMSF035B04+ GTTCCCTGAGCAAAGAGATGACCTAAAACAGTACGTGTTGAAAGAATTTCGT
JMSF026E05+ GTTCCCTGAGCAAAGAGATGACCTAAAACAGTACGTGTTGAAAGAATTTCGT
JMFN008G09+ GTTCCCTGAGCAAAGAGATGA
JMFF015F10+ GTTCCCTGAGCAAAGAGATGACCTAAAACAGTACGTGTTGAAAGAATT
JMFF019N03+ GTTCCCTGAGCAAAGAGATGACCTAAAACAGTA
JMSF019I01+ GTTCCCTGAGCAAAGAGATGACCTAAAACAGTACGTGTTGAAAGAATTTCGT
JMSF022L23+ GTTCCCTGAGCAAAGAGATGACCTAAAACAGTACGTGTTGAAAGAATTTCGTAATCTCTC
                      ____________________________________________________________
consensus GTTCCCTGAGCAAAGAGATGACCTAAAACAGTACGTGTTGAAAGAATTTCGTAATCTCTC