Previous Contig 006087:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043C22Sequence644006087 (6)560010283 (5)pir|S48856|S488560.005finger protein pcp1 - potato>gb:STPCP1_1722848 S.tuberosum mRNA for DNA/RNA bind
JMFF043E14Sequence557006087 (6)561010283 (5)pir|S48856|S488560.005finger protein pcp1 - potato>gb:STPCP1_1722848 S.tuberosum mRNA for DNA/RNA bind
JMFF050B07Sequence555006087 (6)560010283 (5)pir|S48856|S488560.005finger protein pcp1 - potato>gb:STPCP1_1722848 S.tuberosum mRNA for DNA/RNA bind
JMFS121E09Sequence559006087 (6)
JMSF022L09Sequence488006087 (6)
JMSF025A14Sequence667006087 (6)gb:AY568673_11786531e-89Arabidopsis thaliana At3g13810 (At3g13810) mRNA, complete cds.>gb:AJ630504_18127758010283 (5)pir|S48856|S488563e-05finger protein pcp1 - potato>gb:STPCP1_1722848 S.tuberosum mRNA for DNA/RNA bind

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025A14+ GAGAAAAGGGTTCCACAGTCACATCTGTATTCTCTTGTGC
                      ____________________________________________________________
consensus GAGAAAAGGGTTCCACAGTCACATCTGTATTCTCTTGTGC
 
. : . : . : . : . : . :
JMSF025A14+ CACAGGTTTTGGAGTGAGCTTTCCAGTCAGATTGAACTGCATATCTCTTTGAGCACTTGT
                      ____________________________________________________________
consensus CACAGGTTTTGGAGTGAGCTTTCCAGTCAGATTGAACTGCATATCTCTTTGAGCACTTGT
 
. : . : . : . : . : . :
JMSF025A14+ CACATTTCCACTTCTTCTCCCCATGCTTTCTGCAAAAGTGTTTCTTGATCCCAGTGAGGT
                      ____________________________________________________________
consensus CACATTTCCACTTCTTCTCCCCATGCTTTCTGCAAAAGTGTTTCTTGATCCCAGTGAGGT
 
. : . : . : . : . : . :
JMSF025A14+ CACCCAGGGCCCTGGCTGGTTCATGGTGGACACAGCTCGCCTCTGGGCACACATACACCT
                      ____________________________________________________________
consensus CACCCAGGGCCCTGGCTGGTTCATGGTGGACACAGCTCGCCTCTGGGCACACATACACCT
 
. : . : . : . : . : . :
JMSF025A14+ TCTTCCTTATCACTTCCTTGTTGCTTCTCTGCTTCAGCTTCCATGGCAGATTGTGACCCC
                      ____________________________________________________________
consensus TCTTCCTTATCACTTCCTTGTTGCTTCTCTGCTTCAGCTTCCATGGCAGATTGTGACCCC
 
. : . : . : . : . : . :
JMSF025A14+ TTCTGTGAAGCTGCAGATTCTGGTCCCTCTGAAACCCTTTGTTGCAAATTTCACACACAA
                      ____________________________________________________________
consensus TTCTGTGAAGCTGCAGATTCTGGTCCCTCTGAAACCCTTTGTTGCAAATTTCACACACAA
 
. : . : . : . : . : . :
JMSF025A14+ ATCTGTTGGTTGCCATCAGAGTCTTGGGTGACAAAGCTATCACTTCTGCATCAGGGTCTG
                      ____________________________________________________________
consensus ATCTGTTGGTTGCCATCAGAGTCTTGGGTGACAAAGCTATCACTTCTGCATCAGGGTCTG
 
. : . : . : . : . : . :
JMSF025A14+ GATTTCCTGGTTGGTTTCTCTTCTTCTTGACTGGTTGAGACTGATTTGGGTTAGCAAAGA
JMFF043C22+ TGACTGGTTGAGACTGATTTGGGTTAGCAAAGA
                      ____________________________________________________________
consensus GATTTCCTGGTTGGTTTCTCTTCTTCTTGACTGGTTGAGACTGATTTGGGTTAGCAAAGA
 
. : . : . : . : . : . :
JMSF025A14+ CCTGTTGTTGGTGGGGATAGATGCCGCCATTAGTGTCAGAAACAGAAGCTTCACCGGAGG
JMFF043C22+ CCTGTTGTTGGTGGGGATAGATGCCGCCATTAGTGTCAGAAACAGAAGCTTCACCGGAGG
JMFF043E14+ GAGG
                      ____________________________________________________________
consensus CCTGTTGTTGGTGGGGATAGATGCCGCCATTAGTGTCAGAAACAGAAGCTTCACCGGAGG
 
. : . : . : . : . : . :
JMSF025A14+ CAGTAGAAGTGAGATTAGACATGTTTTCTTGATCCAAAGCTGAATGTGGCTGCTGAATTA
JMFF043C22+ CAGTAGAAGTGAGATTAGACATGTTTTCTTGATCCAAAGCTGAATGTGGCTGCTGAATTA
JMFF043E14+ CAGTAGAAGTGAGATTAGACATGTTTTCTTGATCCAAAGCTGAATGTGGCTGCTGAATTA
                      ____________________________________________________________
consensus CAGTAGAAGTGAGATTAGACATGTTTTCTTGATCCAAAGCTGAATGTGGCTGCTGAATTA
 
. : . : . : . : . : . :
JMSF025A14+ CCAGACCTTTCATCATCATCTTCCTCCAAAGCTAAAGC
JMFF043C22+ CCAGACCTTTCATCATCATCTTCCTCCAAAGCTAAAGCCTACCATTATCAGCAAAGCAGA
JMFF043E14+ CCAGACCTTTCATCATCATCTTCCTCCAAAGCTAAAGCCTACCATTATCAGCAAAGCAGA
                      ____________________________________________________________
consensus CCAGACCTTTCATCATCATCTTCCTCCAAAGCTAAAGCCTACCATTATCAGCAAAGCAGA
 
. : . : . : . : . : . :
JMFF043C22+ TATCTGTCAATTTCTGATAATCTATCACCTAGGAGTCAAAAAGTTGGGATCTTTCCTCCC
JMFF043E14+ TATCTGTCAATTTCTGATAATCTATCACCTAGGAGTCAAAAAGTTGGGATCTTTCCTCCC
JMFS121E09+ TAGGAGTCAAAAAGTTGGGATCTTTCCTCCC
                      ____________________________________________________________
consensus TATCTGTCAATTTCTGATAATCTATCACCTAGGAGTCAAAAAGTTGGGATCTTTCCTCCC
 
. : . : . : . : . : . :
JMFF043C22+ AAAAAAAAAAAAAAAAACCATTAGTTTAAGTAAGATATATACTGAGATCTGAAGACAAAC
JMFF043E14+ AAAAAAAAAAAAAAAAACCATTAGTTTAAGTAAGATATATACTGAGATCTGAAGACAAAC
JMFF050B07+ CTGAGATCTGAAGACAAAC
JMFS121E09+ AAAAAAAAAAAAAAAAACCATTAGTTTAAGTAAGATATATACTGAGATCTGAAGACAAAC
JMSF022L09+ GACANAC
                      ____________________________________________________________
consensus AAAAAAAAAAAAAAAAACCATTAGTTTAAGTAAGATATATACTGAGATCTGAAGACAAAC
 
. : . : . : . : . : . :
JMFF043C22+ CCAAACCTAGAAAAAGGTCAAGTAGGTGATGAGAAAATGGACAAAGTGAAAGAGAGAGAG
JMFF043E14+ CCAAACCTAGAAAAAGGTCAAGTAGGTGATGAGAAAATGGACAAAGTGAAAGAGAGAGAG
JMFF050B07+ CCAAACCTAGAAAAAGGTCAAGTAGGTGATGAGAAAATGGACAAAGTGAAAGAGAGAGAG
JMFS121E09+ CCAAACCTAGAAAAAGGTCAAGTAGGTGATGAGAAAATGGACAAAGTGAAAGAGAGAGAG
JMSF022L09+ CCACACCTAGAAAAAGGTCACGTAGGTGATGAGAAAATGGACANAGTGAAAGAGAGAGAG
                      ____________________________________________________________
consensus CCAAACCTAGAAAAAGGTCAAGTAGGTGATGAGAAAATGGACAAAGTGAAAGAGAGAGAG
 
. : . : . : . : . : . :
JMFF043C22+ AGAGAGTAAAATAAATGGCAGAAATTTCTTGTTTGAACCTCCAAAACACCTCTACAGCCT
JMFF043E14+ AGAGAGTAAAATAAATGGCAGAAATTTCTTGTTTGAACCTCCAAAACACCTCTACAGCCT
JMFF050B07+ AGAGAGTAAAATAAATGGCAGAAATTTCTTGTTTGAACCTCCAAAACACCTCTACAGCCT
JMFS121E09+ AGAGAGTAAAATAAATGGCAGAAATTTCTTGTTTGAACCTCCAAAACACCTCTACAGCCT
JMSF022L09+ AGAGAGTAAAATAAATGGCAGAAATTTCTTGTTTGAACCTCCAAAACACCTCTACAGCCT
                      ____________________________________________________________
consensus AGAGAGTAAAATAAATGGCAGAAATTTCTTGTTTGAACCTCCAAAACACCTCTACAGCCT
 
. : . : . : . : . : . :
JMFF043C22+ TAGCTCCTTCTCTCCCTTGGCAGCACCCCAACAGACAATTCTTGTTTTTTGCAAAAGCTA
JMFF043E14+ TAGCTCCTTCTCTCCCTTGGCAGCACCCCAACAGACAATTCTTGTTTTTTGCAAAAGCTA
JMFF050B07+ TAGCTCCTTCTCTCCCTTGGCAGCACCCCAACAGACAATTCTTGTTTTTTGCAAAAGCTA
JMFS121E09+ TAGCTCCTTCTCTCCCTTGGCAGCACCCCAACAGACAATTCTTGTTTTTTGCAAAAGCTA
JMSF022L09+ TAGCTCNTTCTCTCCCTTGGCAGCACCCCANCAGACAATTCTTGTTTTTTGCAAAAGCTA
                      ____________________________________________________________
consensus TAGCTCCTTCTCTCCCTTGGCAGCACCCCAACAGACAATTCTTGTTTTTTGCAAAAGCTA
 
. : . : . : . : . : . :
JMFF043C22+ AAAGGAGAGAAAGAAAAATGGAGAATTGAAAGTGTTTTTCAGAAAGAGAGAGAGAGAGAG
JMFF043E14+ AAAGGAGAGAAAGAAAAATGGAGAATTGAAAGTGTTTTTCAGAAAGAGAGAGAGAGAGAG
JMFF050B07+ AAAGGAGAGAAAGAAAAATGGAGAATTGAAAGTGTTTTTCAGAAAGAGAGAGAGAGAGAG
JMFS121E09+ AAAGGAGAGAAAGAAAAATGGAGAATTGAAAGTGTTTTTCAGAAAGAGAGAGAGAGAGAG
JMSF022L09+ AAAGGAGAGAAAGAAAAATGGAGAATTGAAAGTGTTTTTCNGAAAGAGAGAGAGAGAGAG
                      ____________________________________________________________
consensus AAAGGAGAGAAAGAAAAATGGAGAATTGAAAGTGTTTTTCAGAAAGAGAGAGAGAGAGAG
 
. : . : . : . : . : . :
JMFF043C22+ AGAGAGAGAGATGACCCTCAAACTGAATTAAATCTGGAAAA-CCCAGTNGCTCCCCTTCA
JMFF043E14+ AGAGAGAGAGATGACCCTCAAACTGAATTAAATCTGGAAAACCCCAGT-GCTCCCCTTCA
JMFF050B07+ AGAGAGAGAGATGACCCTCAAACTGAATTAAATCTGGAAAA-CCCAGT-GCTCCCCTTCA
JMFS121E09+ AGAGAGAGAGATGACCCTCAAACTGAATTAAATCTGGAAAA-CCCAGT-GCTCCCCTTCA
JMSF022L09+ AGAGAGAGAGATGACCCTCAAACTGAATTAAATCTGGAAAA-CCCAGT-GCTCCCCTTCA
                      ____________________________________________________________
consensus AGAGAGAGAGATGACCCTCAAACTGAATTAAATCTGGAAAA-CCCAGT-GCTCCCCTTCA
 
. : . : . : . : . : . :
JMFF043C22+ AGAATCATCAAC
JMFF043E14+ AGAATCATCAAC
JMFF050B07+ AGAATCATCAAC
JMFS121E09+ AGAATCATCAACACCCATTCTTGCTAAAATCAAGAAAATCCTATAATAAATCCATGCACA
JMSF022L09+ AGAATCATCAACACCCATTCTTGCTAAAATCAAGAAAATCCTATAATAAATCCATGCACA
                      ____________________________________________________________
consensus AGAATCATCAACACCCATTCTTGCTAAAATCAAGAAAATCCTATAATAAATCCATGCACA
 
. : . : . : . : . : . :
JMFS121E09+ TAAGAACAAATAAACTGGACCAAGTTTTATAACAAGTAGGGAGAGTGGGAGAGAGAGAGA
JMSF022L09+ TAAGAACAAATAAACTGGACCAAGTTTTATAACAAGTAGGGAGAGTGGGAGAGAGAGAGA
                      ____________________________________________________________
consensus TAAGAACAAATAAACTGGACCAAGTTTTATAACAAGTAGGGAGAGTGGGAGAGAGAGAGA
 
. : . : . : . : . : . :
JMFS121E09+ GAGAGAAAGAGACAGACATGTGGATGAGAAGTGAAGAGTAATCCTTCTGC
JMSF022L09+ GAGAGAAAGAGACAGACATGTGGATGAGAAGTGAAGAGTAATCCTTCTGCGTATATCTCC
                      ____________________________________________________________
consensus GAGAGAAAGAGACAGACATGTGGATGAGAAGTGAAGAGTAATCCTTCTGCGTATATCTCC