Previous Contig 006084:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025D13Sequence557006084 (12)gb:AY086389_15714382e-07Arabidopsis thaliana clone 24864 mRNA, complete sequence.687006084 (12)gb:BT008340_16395575e-21Arabidopsis thaliana At5g20700 mRNA, complete cds.>gb:AK117339_1815378 Arabidops
JMFF029D20Sequence414006084 (12)gb:BT000460_16347380.003Arabidopsis thaliana expressed protein (At1g74940) mRNA, complete cds.>gb:BT0025738006084 (12)gb:AY086389_15714384e-20Arabidopsis thaliana clone 24864 mRNA, complete sequence.
JMFN043O05Sequence624006084 (12)gb:AY086389_15714382e-14Arabidopsis thaliana clone 24864 mRNA, complete sequence.
JMSF009O19Sequence236006084 (12)755006084 (12)gb:AY086389_15714383e-21Arabidopsis thaliana clone 24864 mRNA, complete sequence.
JMSF018H11Sequence514006084 (12)gb:BT000460_16347380.004Arabidopsis thaliana expressed protein (At1g74940) mRNA, complete cds.>gb:BT0025757022823gb:BT008340_16395578e-15Arabidopsis thaliana At5g20700 mRNA, complete cds.>gb:AK117339_1815378 Arabidops
JMSF022K20Sequence642006084 (12)gb:AY086389_15714384e-12Arabidopsis thaliana clone 24864 mRNA, complete sequence.753006084 (12)gb:AY086389_15714383e-20Arabidopsis thaliana clone 24864 mRNA, complete sequence.
JMSF023L05Sequence654006084 (12)gb:AY086389_15714383e-13Arabidopsis thaliana clone 24864 mRNA, complete sequence.730006084 (12)gb:AY086389_15714383e-21Arabidopsis thaliana clone 24864 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF029D20- AAG
                      ____________________________________________________________
consensus AAG
 
. : . : . : . : . : . :
rJMFF029D20- CATCAAGAATCTATGCAAGAAGAAANAAGACTTCAAAATTTTCATTACAGGAGCATAAAG
                      ____________________________________________________________
consensus CATCAAGAATCTATGCAAGAAGAAANAAGACTTCAAAATTTTCATTACAGGAGCATAAAG
 
. : . : . : . : . : . :
rJMFF029D20- ATGAGATCTTTATCTTTATATCCGGGCAAAAATATTTCGTTCCCGTGAGGGAGATGATCG
rJMFF025D13- TGAGATCTTTATCTTTATATCCGGGCAAAAATATTTCGTTCCCGTGAGGGAGATGATCG
rJMSF023L05- TGAGATCTTTATCTTTATATCCGGGCAAAAATATTTCGTTCCCGTGAGGGAGATGATCG
rJMSF022K20- AAATATTTCGTTCCCGTGAGGGAGATGATCG
rJMSF009O19- TATTTCGTTCCCGTGAGGGAGATGATCG
                      ____________________________________________________________
consensus ATGAGATCTTTATCTTTATATCCGGGCAAAAATATTTCGTTCCCGTGAGGGAGATGATCG
 
. : . : . : . : . : . :
rJMFF029D20- TCGTCGTTGACGTTGTTGTTTCTCAGGCGTACCGTATAAAGAAGTAATATTCCGGAGTTA
rJMFF025D13- TCGTCGTTGACGTTGTTGTTTCTCAGGCGTACCGTATAAAGAAGTAATATTCCGGAGTTA
rJMSF023L05- TCGTCGTTGACGTTGTTGTTTCTCAGGCGTACCGTATAAAGAAGTAATATTCCGGAGTTA
rJMSF022K20- TCGTCGTTGACGTTGTTGTTTCTCAGGCGTACCGTATAAAGAAGTAATATTCCGGAGTTA
rJMSF009O19- TCGTCGTTGACGTTGTTGTTTCTCAGGCGTACCGTATAAAGAAGTAATATTCCGGAGTTA
                      ____________________________________________________________
consensus TCGTCGTTGACGTTGTTGTTTCTCAGGCGTACCGTATAAAGAAGTAATATTCCGGAGTTA
 
. : . : . : . : . : . :
rJMFF029D20- TACTTTATACACTAGATCGAATATATACATCGCTACTATATATAATCCATAATCCCCATA
rJMFF025D13- TACTTTATACACTAGATCGAATATATACATCGCTACTATATATAATCCATAATCCCCATA
rJMSF023L05- TACTTTATACACTAGATCGAATATATACATCGCTACTATATATAATCCATAATCCCCATA
rJMSF022K20- TACTTTATACACTAGATCGAATATATACATCGCTACTATATATAATCCATAATCCCCATA
rJMSF009O19- TACTTTATACACTAGATCGAATATATACATCGCTACTATATATAATCCATAATCCCCATA
                      ____________________________________________________________
consensus TACTTTATACACTAGATCGAATATATACATCGCTACTATATATAATCCATAATCCCCATA
 
. : . : . : . : . : . :
rJMFF029D20- CTGGATTAACTGGGAATCAGGGATTAAGGTTTAAGTTTAGTAGGATT--TATTTATTTAT
rJMFF025D13- CTGGATTAACTGGGAATCAGGGATTAAGGTTTAAGTTTAGTAGGATTTATATTTATTTAT
rJMSF023L05- CTGGATTAACTGGGAATCAGGGATTAAGGTTTAAGTTTAGTAGGATTTATATTTATTTAT
rJMSF022K20- CTGGATTAACTGGGAATCAGGGATTAAGGTTTAAGTTTAGTAGGATTTATATTTATTTAT
rJMSF009O19- CTGGATTAACTGGGAATCAGGGATTAAGGTTTAAGTTTAGTAGGATTTATATTTATTTAT
                      ____________________________________________________________
consensus CTGGATTAACTGGGAATCAGGGATTAAGGTTTAAGTTTAGTAGGATTTATATTTATTTAT
 
. : . : . : . : . : . :
rJMFF029D20- TATGCGCCGTTGCCGTCGCCGTCGCCGGCGAGTTATTATGGTTCAGATGGCCAGAATTCC
rJMFF025D13- TATGCGCCGTTGCCGTCGCCGTCGCCGGCGAGTTATTATGGTTCAGATGGCCAGAATTCC
rJMSF023L05- TATGCGCCGTTGCCGTCGCCGTCGCCGGCGAGTTATTATGGTTCAGATGGCCAGAATTCC
rJMSF022K20- TATGCGCCGTTGCCGTCGCCGTCGCCGGCGAGTTATTATGGTTCAGATGGCCAGAATTCC
rJMSF009O19- TATGCGCCGTTGCCGTCGCCGTCGCCGGCGAGTTATTATGGTTCAGATGGCCAGAATTCC
                      ____________________________________________________________
consensus TATGCGCCGTTGCCGTCGCCGTCGCCGGCGAGTTATTATGGTTCAGATGGCCAGAATTCC
 
. : . : . : . : . : . :
rJMFF029D20- GGTTGAAAACATCTGACCGTTTGTATAAGGGGAGGTTGAAATATCGGCGGACCTAGAAAT
rJMFF025D13- GGTTGAAAACATCTGACCGTTTGTATAAGGGGAGGTTGAAATATCGGCGGACCTAGAAAT
rJMSF023L05- GGTTGAAAACATCTGACCGTTTGTATAAGGGGAGGTTGAAATATCGGCGGACCTAGAAAT
rJMSF022K20- GGTTGAAAACATCTGACCGTTTGTATAAGTGGAGGTTGAAATATCGGCGGACCTAGAAAT
rJMSF009O19- GGTTGAAAACATCTGACCGTTTGTATAAGGGGAGGTTGAAATATCGGCGGACCTAGAAAT
                      ____________________________________________________________
consensus GGTTGAAAACATCTGACCGTTTGTATAAGGGGAGGTTGAAATATCGGCGGACCTAGAAAT
 
. : . : . : . : . : . :
rJMFF029D20- CTCAGAACTGCACTTCTCTTTGTGCTCGTCCATCACTATCTGCCGATATCTACACTCCGT
rJMFF025D13- CTCAGAACTGCACTTCTCTTTGTGCTCGTCCATCACTATCTGCCGATATCTACACTCCGT
rJMSF023L05- CTCAGAACTGCACTTCTCTTTGTGCTCGTCCATCACTATCTGCCGATATCTACACTCCGT
rJMSF022K20- CTCAGAACTGCACTTCTCTTTGTGCTCGTCCATCACTATCTGCCGATATCTACACTCCGT
rJMSF009O19- CTCAGAACTGCACTTCTCTTTGTGCTCGTCCATCACTATCTGCCGATATCTACACTCCGT
                      ____________________________________________________________
consensus CTCAGAACTGCACTTCTCTTTGTGCTCGTCCATCACTATCTGCCGATATCTACACTCCGT
 
. : . : . : . : . : . :
rJMFF029D20- GCTACAAAACGCCGTTTCACCCCTGTACATGTAAATGTCTTTGCCGGAGAGTTTTTTACG
rJMFF025D13- GCTACAAAACGCCGTTTCACCCCTGTACATGTAAATGTCTTTGCCGGAGAGTTTTTTACG
rJMSF023L05- GCTACAAAACGCCGTTTCACCCCTGTACATGTAAATGTCTTTGCCGGAGAGTTTTTTACG
rJMSF022K20- GCTACAAAACGCCGTTTCACCCCTGTACATGTAAATGTCTTTGCCGGAGAGTTTTTTACG
rJMSF009O19- GCTACAAAACGCCGTTTCACCCCTGTACATGTAAATGTCTTTGCCGGAGAGTTTTTTACG
JMFF025D13+ TGCCGGAGAGTTTTTTACG
JMFN043O05+ ACAAAACGCCGTTTCACCCCTGTACATGTAAATGTCTTTGCCGGAGAGTTTTTTACG
JMSF023L05+ AAACGCCGTTTCACCCCTGTACATGTAAATGTCTTTGCCGGAGAGTTTTTTACG
JMSF022K20+ ACCCCTGTACATGTAAATGTCTTTGCCGGAGAGTTTTTTACG
                      ____________________________________________________________
consensus GCTACAAAACGCCGTTTCACCCCTGTACATGTAAATGTCTTTGCCGGAGAGTTTTTTACG
 
. : . : . : . : . : . :
rJMFF029D20- GCATAAATGGCAGGAGCTGAGGAAATCGGAATCCGGGCACGCCGGAATATCGGCGAGCCT
rJMFF025D13- GCATAAATGGCAGGAGCTGAGGAAATCGGAATCCGGGCACGCCGGAATATCGGCGAGCCT
rJMSF023L05- GCATAAATGGCAGGAGCTGAGGAAATCGGAATCCGGGCACGCCGGAATATCGGCGAGCCT
rJMSF022K20- GCATAAATGGCAGGAGCTGAGGAAATCGGAATCCGGGCACGCCGGAATATCGGCGAGCCT
rJMSF009O19- GCATAAATGGCAGGAGCTGAGGAAATCGGAATCCGGGCACGCCGGAATATCGGCGAGCCT
JMFF025D13+ GCATAAATGGCAGGAGCTGAGGAAATCGGAATCCGGGCACGCCGGAATATCGGCGAGCCT
JMFN043O05+ GCATAAATGGCAGGAGCTGAGGAAATCGGAATCCGGGCACGCCGGAATATCGGCGAGCCT
JMSF023L05+ GCATAAATGGCAGGAGCTGAGGAAATCGGAATCCGGGCACGCCGGAATATCGGCGAGCCT
JMSF022K20+ GCATAAATGGCAGGAGCTGAGGAAATCGGAATCCGGGCACGCCGGAATATCGGCGAGCCT
                      ____________________________________________________________
consensus GCATAAATGGCAGGAGCTGAGGAAATCGGAATCCGGGCACGCCGGAATATCGGCGAGCCT
 
. : . : . : . : . : . :
rJMFF029D20- CGCCGGAGATATCGTGAAAACGCTCGGGCGGTTGCTTCTGGAGCTCGGGACTTCGCCGTA
rJMFF025D13- CGCCGGAGATATCGTGAAAACGCTCGGGCGGTTGCTTCTGGAGCTCGGGACTTCGCCGTA
rJMSF023L05- CGCCGGAGATATCGTGAAAACGCTCGGGCGGTTGCTTCTGGAGCTCGGGACTTCGCCGTA
rJMSF022K20- CGCCGGAGATATCGTGAAAACGCTCGGGCGGTTGCTTCTGGAGCTCGGGACTTCGCCGTA
rJMSF009O19- CGCCGGAGATATCGTGAAAACGCTCGGGCGGTTGCTTCTGGAGCTCGGGACTTCGCCGTA
JMFF025D13+ CGCCGGAGATATCGTGAAAACGCTCGGGCGGTTGCTTCTGGAGCTCGGGACTTCGCCGTA
JMFN043O05+ CGCCGGAGATATCGTGAAAACGCTCGGGCGGTTGCTTCTGGAGCTCGGGACTTCGCCGTA
JMSF023L05+ CGCCGGAGATATCGTGAAAACGCTCGGGCGGTTGCTTCTGGAGCTCGGGACTTCGCCGTA
JMSF018H11+ TCGGGCGGTTGCTTCTGGAGCTCGGGACTTCGCCGTA
JMSF022K20+ CGCCGGAGATATCGTGAAAACGCTCGGGCGGTTGCTTCTGGAGCTCGGGACTTCGCCGTA
                      ____________________________________________________________
consensus CGCCGGAGATATCGTGAAAACGCTCGGGCGGTTGCTTCTGGAGCTCGGGACTTCGCCGTA
 
. : . : . : . : . : . :
rJMFF029D20- GACTCTAGTGTACGGTTTGTTGTCGGAGCCGCGGCAAGTCACCACCGAATACTCTTCTTC
rJMFF025D13- GACTCTAGTGTACGGTTTGTTGTCGGAGCCGCGGCAAGTCACCACCGTATACTCTTCTTC
rJMSF023L05- GACTCTAGTGTACGGTTTGTTGTCGGAGCCGCGGCAAGTCACCACCGTATACTCTTCTTC
rJMSF022K20- GACTCTAGTGTACGGTTTGTTGTCGGAGCCGCGGCAAGTCACCACCGTATACTCTTCTTC
rJMSF009O19- GACTCTAGTGTACGGTTTGTTGTCGGAGCCGCGGCAAGTCACCACCGTATACTCTTCTTC
JMFF025D13+ GACTCTAGTGTACGGTTTGTTGTCGGAGCCGCGGCAAGTCACCACCGTATACTCTTCTTC
JMFN043O05+ GACTCTAGTGTACGGTTTGTTGTCGGAGCCGCGGCAAGTCACCACCGTATACTCTTCTTC
JMSF023L05+ GACTCTAGTGTACGGTTTGTTGTCGGAGCCGCGGCAAGTCACCACCGTATACTCTTCTTC
JMSF018H11+ GACTCTAGTGTACGGTTTGTTGTCGGAGCCGCGGCAAGTCACCACCGTATACTCTTCTTC
JMSF022K20+ GACTCTAGTGTACGGTTTGTTGTCGGAGCCGCGGCAAGTCACCACCGTATACTCTTCTTC
                      ____________________________________________________________
consensus GACTCTAGTGTACGGTTTGTTGTCGGAGCCGCGGCAAGTCACCACCGTATACTCTTCTTC
 
. : . : . : . : . : . :
rJMFF029D20- TTCTTCTTCTTCCTCCA
rJMFF025D13- TTCTTCTTCTTCCTCCAGGCTCCCTCTA
rJMSF023L05- TTCTTCTTCTTCCTCCAGGCTCCCTCTAAAACTCCCCACAATTCTCGCCGGAATCCTCCC
rJMSF022K20- TTCTTCTTCTTCCTCCAGGCTCCCTCTAAAACTCCCCACAATTCTCGCCGGAATCCTCCC
rJMSF009O19- TTCTTCTTCTTCCTCCAGGCTCCCTCTAAAACTCCCCACAATTCTCGCCGGAATCCTCCC
JMFF025D13+ TTCTTCTTCTTCCTCCAGGCTCCCTCTAAAACTCCCCACAATTCTCGCCGGAATCCTCCC
JMFN043O05+ TTCTTCTTCTTCCTCCAGGCTCCCTCTAAAACTCCCCACAATTCTCGCCGGAATCCTCCC
JMSF023L05+ TTCTTCTTCTTCCTCCAGGCTCCCTCTAAAACTCCCCACAATTCTCGCCGGAATCCTCCC
JMSF018H11+ TTCTTCTTCTTCCTCCAGGCTCCCTCTAAAACTCCCCACAATTCTCGCCGGAATCCTCCC
JMFF029D20+ CTTCTTCCTCCAGGCTCCCTCTAAAACTCCCCACAATTCTCGCCGGAATCCTCCC
JMSF022K20+ TTCTTCTTCTTCCTCCAGGCTCCCTCTAAAACTCCCCACAATTCTCGCCGGAATCCTCCC
                      ____________________________________________________________
consensus TTCTTCTTCTTCCTCCAGGCTCCCTCTAAAACTCCCCACAATTCTCGCCGGAATCCTCCC
 
. : . : . : . : . : . :
rJMSF023L05- GGAGCTC
rJMSF022K20- GGAGCTCACCGGAATCGGCACCGACCGCCGCGAATTCCGGCTACACACCACTTTTC
rJMSF009O19- GGAGCTCACCGGAATCGGCACCGACCGCCGCGAATTCCGGCTACACACCANTTTTCTCCC
JMFF025D13+ GGAGCTCACCGGAATCGGCACCGACCGCCGCGAATTCCGGCTACACACCACTTTTCTCCC
JMFN043O05+ GGAGCTCACCGGAATCGGCACCGACCGCCGCGAATTCCGGCTACACACCACTTTTCTCCC
JMSF023L05+ GGAGCTCACCGGAATCGGCACCGACCGCCGCGAATTCCGGCTACACACCACTTTTCTCCC
JMSF018H11+ GGAGCTCACCGGAATCGGCACCGACCGCCGCGAATTCCGGCTACACACCACTTTTCTCCC
JMFF029D20+ GGAGCTCACCGGAATCGGCACCGACCGCCGCGAATTCCGGCTACACACCACTTTTCTCCC
JMSF022K20+ GGAGCTCACCGGAATCGGCACCGACCGCCGCGAATTCCGGCTACACACCACTTTTCTCCC
                      ____________________________________________________________
consensus GGAGCTCACCGGAATCGGCACCGACCGCCGCGAATTCCGGCTACACACCACTTTTCTCCC
 
. : . : . : . : . : . :
rJMSF009O19- CGCACTC
JMFF025D13+ CGCACTCTCCCCTCTCTCACAAGATTTTTCCAGGGCGGCAACAATCGCCAGCCCAACCCC
JMFN043O05+ CGCACTCTCCCCTCTCTCACAAGATTTTTCCAGGGCGGCAACAATCGCCAGCCCAACCCC
JMSF023L05+ CGCACTCTCCCCTCTCTCACAAGATTTTTCCAGGGCGGCAACAATCGCCAGCCCAACCCC
JMSF018H11+ CGCACTCTCCCCTCTCTCACAAGATTTTTCCAGGGCGGCAACAATCGCCAGCCCAACCCC
JMFF029D20+ CGCACTCTCCCCTATCTCACAAGATTTTTCCAGGGCGGCAACAATCGCCAGCCCAACCCC
JMSF022K20+ CGCACTCTCCCCTCTCTCACAAGATTTTTCCAGGGCGGCAACAATCGCCAGCCCAACCCC
                      ____________________________________________________________
consensus CGCACTCTCCCCTCTCTCACAAGATTTTTCCAGGGCGGCAACAATCGCCAGCCCAACCCC
 
. : . : . : . : . : . :
JMFF025D13+ TCCAAGATCGAAACTTTTTAGCCCTCTCGGCGACTGAACCTTGTGGTCCAAAGGACTTCT
JMFN043O05+ TCCAAGATCGAAACTTTTTAGCCCTCTCGGCGACTGAACCTTGTGGTCCAAAGGACTTCT
JMSF023L05+ TCCAAGATCGAAACTTTTTAGCCCTCTCGGCGACTGAACCTTGTGGTCCAAAGGACTTCT
JMSF018H11+ TCCAAGATCGAAACTTTTTAGCCCTCTCGGCGACTGAACCTTGTGGTCCAAAGGACTTCT
JMSF009O19+ CCAAGATCGAAACTTTTTAGCCCTCTCGGCGACTGAACCTTGTGGTCCAAAGGACTTCT
JMFF029D20+ TCCAAGATCGAAACTTTTTAGCCCTCTCGGCGACTGAACCTTGTGGTCCAAAGGACTTCT
JMSF022K20+ TCCAAGATCGAAACTTTTTAGCCCTCTCGGCGACTGAACCTTGTGGTCCAAAGGACTTCT
                      ____________________________________________________________
consensus TCCAAGATCGAAACTTTTTAGCCCTCTCGGCGACTGAACCTTGTGGTCCAAAGGACTTCT
 
. : . : . : . : . : . :
JMFF025D13+ CGGGCTGGTCGGCCCGCCGGCTATCTTTCCGGCCACCGGGTTTAATCTCTTGCCCAGCAT
JMFN043O05+ CGGGCTGGTCGGCCCGCCGGCTATCTTTCCGGCCACCGGGTTTAATCTCTTGCCCAGCAT
JMSF023L05+ CGGGCTGGTCGGCCCGCCGGCTATCTTTCCGGCCACCGGGTTTAATCTCTTGCCCAGCAT
JMSF018H11+ CGGGCTGGTCGGCCCGCCGGCTATCTTTCCGGCCACCGGGTTTAATCTCTTGCCCAGCAT
JMSF009O19+ CGGGCTGGTCGGCCCGCCGGCTATCTTTCCGGCCACCGGGTTTAATCTCTTGCCCAGCAT
JMFF029D20+ CGGGCTGGTCGGCCCGCCGGCTATCTTTCCGGCCACCGGGTTTAATCTCTTGCCCAGCAT
JMSF022K20+ CGGGCTGGTCGGCCCGCCGGCTATCTTTCCGGCCACCGGGTTTAATCTCTTGCCCAGCAT
                      ____________________________________________________________
consensus CGGGCTGGTCGGCCCGCCGGCTATCTTTCCGGCCACCGGGTTTAATCTCTTGCCCAGCAT
 
. : . : . : . : . : . :
JMFF025D13+ AGCTATGGCGGATTTTTGTTCTGGTTTGAAGGGATAGAAAATTGAGTTCTTTTGGAGT
JMFN043O05+ AGCTATGGCGGATTTTTGTTCTGGTTTGAAGGGATAGAAAATTGAGTTCTTTTGGAGTGG
JMSF023L05+ AGCTATGGCGGATTTTTGTTCTGGTTTGAAGGGATAGAAAATTGAGTTCTTTTGGAGTGG
JMSF018H11+ AGCTATGGCGGATTTTTGTTCTGGTTTGAAGGGATAGAAAATTGAGTTCTTTTGGAGTGG
JMSF009O19+ AGCTATGGCGGATTTTTGTTCTGGTTTGAAGGGATAGAAAATTGAGTTCTTTTGGAGTGG
JMFF029D20+ AGCTATGGCGGATTTTTGTTCTGGTTTGAAGGGATAGAAAATTGAGTTCTTTTGGAGTGG
JMSF022K20+ AGCTATGGCGGATTTTTGTTCTGGTTTGAAGGGATAGAAAATTGAGTTCTTTTGGAGTGG
                      ____________________________________________________________
consensus AGCTATGGCGGATTTTTGTTCTGGTTTGAAGGGATAGAAAATTGAGTTCTTTTGGAGTGG
 
. : . : . : . : . : . :
JMFN043O05+ AAAATGGAGAGAGTTGCAGAGGTGATT
JMSF023L05+ AAAATGGAGAGAGTTGCAGAGGTGATTTTATACACAGTATTGAAGAAGATGGAGTTG
JMSF018H11+ AAAATGGAGAGAGTTGCAGAGGTGATTTTATACACAGTATTGAAGAAGATGGAGTTG
JMSF009O19+ AAAATGGAGAGAGTTGCAGAGGTGATTTTATACACAGTATTGAAGAAGATGGAGT
JMFF029D20+ AAAATGGAGAGAGTTGCAGAGGTGATTTTATACACAGTATTGAAGAAGATGGAGTTG
JMSF022K20+ AAAATGGAGAGAGTTGCAGAGGTGATTTTATACACAGTATTGAAGAAGATGGAGTTGTTC
                      ____________________________________________________________
consensus AAAATGGAGAGAGTTGCAGAGGTGATTTTATACACAGTATTGAAGAAGATGGAGTTGTTC