Previous Contig 006082:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006G14Sequence488006082 (4)gb:AY040526_12890077e-06Aplysia californica enterin precursor protein (ENPP) mRNA, complete cds.741008834 (5)pir|T04736|T047367e-62hypothetical protein F6G17.70 - Arabidopsis thaliana>gb:ATCHRIV87_1547696 Arabid
JMFF008D21Sequence590006082 (4)pir|T04736|T047366e-10hypothetical protein F6G17.70 - Arabidopsis thaliana>gb:ATCHRIV87_1547696 Arabid720008834 (5)pir|T04736|T047365e-45hypothetical protein F6G17.70 - Arabidopsis thaliana>gb:ATCHRIV87_1547696 Arabid
JMFF013K20Sequence480006082 (4)pir|T04736|T047362e-04hypothetical protein F6G17.70 - Arabidopsis thaliana>gb:ATCHRIV87_1547696 Arabid659008834 (5)pir|T04736|T047363e-40hypothetical protein F6G17.70 - Arabidopsis thaliana>gb:ATCHRIV87_1547696 Arabid
JMSF022K16Sequence686006082 (4)pir|T04736|T047363e-16hypothetical protein F6G17.70 - Arabidopsis thaliana>gb:ATCHRIV87_1547696 Arabid816008834 (5)pir|T04736|T047369e-58hypothetical protein F6G17.70 - Arabidopsis thaliana>gb:ATCHRIV87_1547696 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022K16+ TGATGGTTCCGGTTGATACCTTGACGG
                      ____________________________________________________________
consensus TGATGGTTCCGGTTGATACCTTGACGG
 
. : . : . : . : . : . :
JMFF008D21+ TGATAGAGTCGTATGCC
JMSF022K16+ TTATTGACGCCTTTCACGAACAAAACGACGTCGTTCTCGGTCGTGATAGAGTCGTATGCC
                      ____________________________________________________________
consensus TTATTGACGCCTTTCACGAACAAAACGACGTCGTTCTCGGTCGTGATAGAGTCGTATGCC
 
. : . : . : . : . : . :
JMFF008D21+ AGAAAATTCCACTGGAGTAGAGGCGGTTGTGAATTTTTCGGGGAAGAAGTGAAATTGATC
JMSF022K16+ AGAAAATTCCACTGGAGTAGAGGCGGTTGTGAATTTTTCGGGGAAGAAGTGAAATTGATC
                      ____________________________________________________________
consensus AGAAAATTCCACTGGAGTAGAGGCGGTTGTGAATTTTTCGGGGAAGAAGTGAAATTGATC
 
. : . : . : . : . : . :
JMFF008D21+ AGAGAAGACGAGAGAGTCAAAATCGGCTGCTTCGTCACCTTTCTCCGGCGAGCGTT-CCC
JMFF013K20+ GGCGAGCGTT-CCC
JMFF006G14+ GGCGAGCGTTCCCC
JMSF022K16+ AGAGAAGACGAGAGAGTCAAAATCGGCTGCTTCGTCACCTTTCTCCGGCGAGCGTT-CCC
                      ____________________________________________________________
consensus AGAGAAGACGAGAGAGTCAAAATCGGCTGCTTCGTCACCTTTCTCCGGCGAGCGTT-CCC
 
. : . : . : . : . : . :
JMFF008D21+ TGGATACTCGCACTTGAACAGTGACCGATCAGGGAACGGCAACACTCCGACGGGGATCGC
JMFF013K20+ TGGATACTCGCACTTGAACAGTGACCGATCAGGGAACGGCAACACTCCGACGGGGATCGC
JMFF006G14+ TGGATACTCGCACTTGAACAGTGACCGATCAGGGAACGGCAACACTCCGACGGGGATCGC
JMSF022K16+ TGGATACTCGCACTTGAACAGTGACCGATCAGGGAACGGCAACACTCCGACGGGGATCGC
                      ____________________________________________________________
consensus TGGATACTCGCACTTGAACAGTGACCGATCAGGGAACGGCAACACTCCGACGGGGATCGC
 
. : . : . : . : . : . :
JMFF008D21+ CGGCGAGGTTTCTCCCTGCTCGAAGAGGCAGACGTAGGGGTCATCTTCATCCCAAGACAG
JMFF013K20+ CGGCGAGGTTTCTCCCTGCTCGAAGAGGCAGACGTAGGGGTCATCTTCATCCCAAGACAG
JMFF006G14+ CGGCGAGGTTTCTCCCTGCTCGAAGAGGCAGACGTAGGGGTCATCTTCATCCCAAGACAG
JMSF022K16+ CGGCGAGGTTTCTCCCTGCTCGAAGAGGCAGACGTAGGGGTCATCTTCATCCCAAGACAG
                      ____________________________________________________________
consensus CGGCGAGGTTTCTCCCTGCTCGAAGAGGCAGACGTAGGGGTCATCTTCATCCCAAGACAG
 
. : . : . : . : . : . :
JMFF008D21+ CGGAGAATATTCCGGCGAGGCGACCACAAATACCTCATAGTCCGGAACCGCGACGGAGAC
JMFF013K20+ CGGAGAATATTCCGGCGAGGCGACCACAAATACCTCATAGTCCGGAACCGCGACGGAGAC
JMFF006G14+ CGGAGAATATTCCGGCGAGGCGACCACAAATACCTCATAGTCCGGAACCGCGACGGAGAC
JMSF022K16+ CGGAGAATATTCCGGCGAGGCGACCACAAATACCTCATAGTCCGGAACCGCGACGGAGAC
                      ____________________________________________________________
consensus CGGAGAATATTCCGGCGAGGCGACCACAAATACCTCATAGTCCGGAACCGCGACGGAGAC
 
. : . : . : . : . : . :
JMFF008D21+ CGCCGGAATCGACGGCGCGGTGGGGACCACTCGACGACCAGGGGCGGCTCCCAGTCTGAA
JMFF013K20+ CGCCGGAATCGACGGCGCGGTGGGGACCACTCGACGACCAGGGGCGGCTCCCAGTCTGAA
JMFF006G14+ CGCCGGAATCGACGGCGCGGTGGGGACCACTCGACGACCAGGGGCGGCTCCCAGTCTGAA
JMSF022K16+ CGCCGGAATCGACGGCGCGGTGGGGACCACTCGACGACCAGGGGCGGCTCCCAGTCTGAA
                      ____________________________________________________________
consensus CGCCGGAATCGACGGCGCGGTGGGGACCACTCGACGACCAGGGGCGGCTCCCAGTCTGAA
 
. : . : . : . : . : . :
JMFF008D21+ ATTCTCAGTGATGAGTTTATTGGCCGTAAAGTCGGCGGCGCTTTTGGTGGTTCGGGGCTG
JMFF013K20+ ATTCTCAGTGATGAGTTTATTGGCCGTAAAGTCGGCGGCGCTTTTGGTGGTTCGGGGCTG
JMFF006G14+ ATTCTCAGTGATGAGTTTATTGGCCGTAAAGTCGGCGGCGCTTTTGGTGGTTCGGGGCTG
JMSF022K16+ ATTCTCAGTGATGAGTTTATTGGCCGTAAAGTCGGCGGCGCTTTTGGTGGTTCGGGGCTG
                      ____________________________________________________________
consensus ATTCTCAGTGATGAGTTTATTGGCCGTAAAGTCGGCGGCGCTTTTGGTGGTTCGGGGCTG
 
. : . : . : . : . : . :
JMFF008D21+ AGCGACGCCGGAAAAGTGAACGGCGTAGTGAGAAACGGCGGCGTGATAGATGCAACGGTT
JMFF013K20+ AGCGACGCCGGAAAAGTGAACGGCGTAGTGAGAAACGGCGGCGTGATAGACGCAACGGTT
JMFF006G14+ AGCGACGCCGGAAAAGTGAACGGCGTAGTGAGAAACGGCGGCGTGATAGATGCAACGGTT
JMSF022K16+ AGCGACGCCGGAAAAGTGAACGGCGTAGTGAGAAACGGCGGCGTGATAGATGCAACGGTT
                      ____________________________________________________________
consensus AGCGACGCCGGAAAAGTGAACGGCGTAGTGAGAAACGGCGGCGTGATAGATGCAACGGTT
 
. : . : . : . : . : . :
JMFF008D21+ GTAGAGCAAGCCGAAGAAGATGAGAAGCGAAACGACGACGTACGCGGAATTCCCACGACC
JMFF013K20+ GTAGAGCAAGCCGAAGAAGATGAGAAGCGAAACGACGACGTACGCGGAATTCCCACGACC
JMFF006G14+ GTAGAGCAAGCCGAAGAAGATGAGAAGCGAAACGACGACGTACGCGGAATTCCCACGACC
JMSF022K16+ GTAGAGCAAGCCGAAGAAGATGAGAAGCGAAACGACGACGTACGCGGAATTCCCACGACC
                      ____________________________________________________________
consensus GTAGAGCAAGCCGAAGAAGATGAGAAGCGAAACGACGACGTACGCGGAATTCCCACGACC
 
. : . : . : . : . : . :
JMFF008D21+ CTTTCTGGCCATTGAGAATCCGGGAGGCGTTAAT
JMFF013K20+ CTTTCTGGCCATTGAGAATCCGGGAGGCGTTAATGGAAGAATGAAAC
JMFF006G14+ CTTTCTGGCCATTGAGAATCCGGGAGGCGTTAATGGAAGAATGAAAC
JMSF022K16+ CTTTCTGGCCATTGAGAATCCGGGAGGCGTTAATGGAAGAATGAAACAGAGATGCTGCTC
                      ____________________________________________________________
consensus CTTTCTGGCCATTGAGAATCCGGGAGGCGTTAATGGAAGAATGAAACAGAGATGCTGCTC