Previous Contig 006077:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN014E17Sequence598006077 (3)gb:AP003287_18273039e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMSF022J09Sequence635006077 (3)gb:AP003287_18273032e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067740006077 (3)gb:AP003287_18273031e-75Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022J09- CCAATAATGGGTATGGTGTGGATAATGTTAACTTCAATATACAACTAT
                      ____________________________________________________________
consensus CCAATAATGGGTATGGTGTGGATAATGTTAACTTCAATATACAACTAT
 
. : . : . : . : . : . :
rJMSF022J09- GAAAAGGAGTCAACTGCACTATGATGCCAAGCCAGTAGGATCAGGAGTGTTCAGTATGAC
                      ____________________________________________________________
consensus GAAAAGGAGTCAACTGCACTATGATGCCAAGCCAGTAGGATCAGGAGTGTTCAGTATGAC
 
. : . : . : . : . : . :
rJMSF022J09- TAGACATAATCACGGAACTAACACCAACTTCATGTTTCTGGGGTTTCTGGGGAAAAGAGA
                      ____________________________________________________________
consensus TAGACATAATCACGGAACTAACACCAACTTCATGTTTCTGGGGTTTCTGGGGAAAAGAGA
 
. : . : . : . : . : . :
rJMSF022J09- TCCGATCCTTTGACCATTCTTCTAAAGCTTTGCGGTGGAGAGCGTTCATCCTGATATAAG
                      ____________________________________________________________
consensus TCCGATCCTTTGACCATTCTTCTAAAGCTTTGCGGTGGAGAGCGTTCATCCTGATATAAG
 
. : . : . : . : . : . :
rJMSF022J09- GCCTCCTTTCTCGGATAAACTTTTCAGCAGTTTTCCAGTCGTCTGCAATGCCCAGAGCTA
                      ____________________________________________________________
consensus GCCTCCTTTCTCGGATAAACTTTTCAGCAGTTTTCCAGTCGTCTGCAATGCCCAGAGCTA
 
. : . : . : . : . : . :
rJMSF022J09- CTAACAGCGCGCACATGACTGCAACACTTCGCCCATGACCATATGCACAATGAACAAAAA
                      ____________________________________________________________
consensus CTAACAGCGCGCACATGACTGCAACACTTCGCCCATGACCATATGCACAATGAACAAAAA
 
. : . : . : . : . : . :
rJMSF022J09- CCGGGATCTTCTGAGCTCTTTTTCGACAAGCCCATTTCACAGCAGCCTCAATATCAGCTG
                      ____________________________________________________________
consensus CCGGGATCTTCTGAGCTCTTTTTCGACAAGCCCATTTCACAGCAGCCTCAATATCAGCTG
 
. : . : . : . : . : . :
rJMSF022J09- GCTGGGGTGACCTAGTATCCCATGTTGGAACACAGAAGTATGCATGATTTCCAGAGAGCT
JMFN014E17+ TGGAACACAGAAGTATGCATGATNTCCAGAGAGCT
JMSF022J09+ TGGAACACAGAAGTATGCATGATTTCCAGAGAGCT
                      ____________________________________________________________
consensus GCTGGGGTGACCTAGTATCCCATGTTGGAACACAGAAGTATGCATGATTTCCAGAGAGCT
 
. : . : . : . : . : . :
rJMSF022J09- CCAACTTCCTTGGCAACTCACAAGTACAATCAATAATAGCAGGTCTACCTGGTGGCAGTT
JMFN014E17+ CCAACTTCCTTGGCAACTCACAAGTACAATCAATAATAGCAGGTCTACCTGGTGGCAGTT
JMSF022J09+ CCAACTTCCTTGGCAACTCACAAGTACAATCAATAATAGCAGGTCTACCTGGTGGCAGTT
                      ____________________________________________________________
consensus CCAACTTCCTTGGCAACTCACAAGTACAATCAATAATAGCAGGTCTACCTGGTGGCAGTT
 
. : . : . : . : . : . :
rJMSF022J09- TATCAGGTGAAGAAGGCCA-CCCCCCTACATACAAACCCTCACATATCTCAGAATAAGGA
JMFN014E17+ TATCAGGTGAAGAAGGCCA-CCCCCCTACATACAAACCCTCACATATCTCAGAATAAGGA
JMSF022J09+ TATCAGGTGAAGAAGGCCACCCCCCCTTACTACAAACCCTCACATATCTCAGAATAAGGA
                      ____________________________________________________________
consensus TATCAGGTGAAGAAGGCCA-CCCCCCTACATACAAACCCTCACATATCTCAGAATAAGGA
 
. : . : . : . : . : . :
rJMSF022J09- GGCTCCCCACTTCTCAGTCTTCTCAATGCTGAGAAGGCCCTCACAAAGTACAAGTATGGG
JMFN014E17+ GGCTCCCCACTTCTCAGTCTTCTCAATGCTGAGAAGGCCCTCACAAAGTACAAGTATGGG
JMSF022J09+ GGCTCCCCACTTCTCAGTCTTCTCAATGCTGAGAAGGCCCTCACAAAGTACAAGTATGGG
                      ____________________________________________________________
consensus GGCTCCCCACTTCTCAGTCTTCTCAATGCTGAGAAGGCCCTCACAAAGTACAAGTATGGG
 
. : . : . : . : . : . :
rJMSF022J09- CTGAACATGACAAGGGACCATAGTGGGAAAGTCCCATCAGAGCCTTTGCCCAATAGGATT
JMFN014E17+ CTGAACATGACAAGGGACCATAGTGGGAAAGTCCCATCAGAGCCTTTGCCCAATAGGATT
JMSF022J09+ CTGAACATGACAAGGGACCATAGTGGGAAAGTCCCATCAGAGCCTTTGCCCAATAGGATT
                      ____________________________________________________________
consensus CTGAACATGACAAGGGACCATAGTGGGAAAGTCCCATCAGAGCCTTTGCCCAATAGGATT
 
. : . : . : . : . : . :
rJMSF022J09- GGGAGATTGATTAATGGGTTAGAGGCTATTGAA
JMFN014E17+ GGGAGATTGATTAATGGGTTAGAGGCTATTGAAACCAATAAAGATATAAGTGATGCATAG
JMSF022J09+ GGGAGATTGATTAATGGGTTAGAGGCTATTGAAACCAATAAAGATATAAGTGATGCATAG
                      ____________________________________________________________
consensus GGGAGATTGATTAATGGGTTAGAGGCTATTGAAACCAATAAAGATATAAGTGATGCATAG
 
. : . : . : . : . : . :
JMFN014E17+ AGAACAGGGAATGATAACAGAACGAAACCAAGATTCCTAAGATACACAAAAATTATGAAT
JMSF022J09+ AGAACAGGGAATGATAACAGAACGAAACCAAGATTCCTAAGATACACAAAAATTATGAAT
                      ____________________________________________________________
consensus AGAACAGGGAATGATAACAGAACGAAACCAAGATTCCTAAGATACACAAAAATTATGAAT
 
. : . : . : . : . : . :
JMFN014E17+ AAAGTTGCTGCCTTTATCCCTACCAGCACAGAAATTCCGACACCCATTTTAAGTTTCCTG
JMSF022J09+ AAAGTTGCTGCCTTTATCCCTACCAGCACAGAAATTCCGACACCCATTTTAAGTTTCCTG
                      ____________________________________________________________
consensus AAAGTTGCTGCCTTTATCCCTACCAGCACAGAAATTCCGACACCCATTTTAAGTTTCCTG
 
. : . : . : . : . : . :
JMFN014E17+ AAGAAACAACACAGCTTCTGAAGAAAATGAAGTAAATGCTGTGCAGAAGTGAAAAACTGA
JMSF022J09+ AAGAAACAACACAGCTTCTGAAGAAAATGAAGTAAATGCTGTGCAGAAGTGAAAAACTGA
                      ____________________________________________________________
consensus AAGAAACAACACAGCTTCTGAAGAAAATGAAGTAAATGCTGTGCAGAAGTGAAAAACTGA
 
. : . : . : . : . : . :
JMFN014E17+ GAGAGTTCGAGTGACTTTTCTGAATATAAAATGAAGAGAAATTCACCGGTCGATCACTGA
JMSF022J09+ GAGAGTTCGAGTGACTTTTCTGAATATAAAATGAAGAGAAATTCACCGGTCGATCACTGA
                      ____________________________________________________________
consensus GAGAGTTCGAGTGACTTTTCTGAATATAAAATGAAGAGAAATTCACCGGTCGATCACTGA
 
. : . : . : . : . : . :
JMFN014E17+ ACGGAAGAGCAGATGCAATG
JMSF022J09+ ACGGAAGAGCAGATGCAATGGAGCGTATGGGCTGTTTGGCTCTGATCTGTGGCCTCGATC
                      ____________________________________________________________
consensus ACGGAAGAGCAGATGCAATGGAGCGTATGGGCTGTTTGGCTCTGATCTGTGGCCTCGATC