Previous Contig 006071:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036K01Sequence536006071 (2)pir|T48449|T484498e-35fatty acid elongase-like protein - Arabidopsis thaliana>gb:ATT32M21_1555919 Arab712012259 (2)pir|T48449|T484495e-58fatty acid elongase-like protein - Arabidopsis thaliana>gb:ATT32M21_1555919 Arab
JMSF022I04Sequence688006071 (2)pir|T48449|T484497e-55fatty acid elongase-like protein - Arabidopsis thaliana>gb:ATT32M21_1555919 Arab689012259 (2)pir|T48449|T484495e-55fatty acid elongase-like protein - Arabidopsis thaliana>gb:ATT32M21_1555919 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022I04+ TACCAATTTGCCCCTAGCGATTCCGTGC
                      ____________________________________________________________
consensus TACCAATTTGCCCCTAGCGATTCCGTGC
 
. : . : . : . : . : . :
JMSF022I04+ TGACAACAATAGCGTAGGAGTTCTTGTAGACCTTGAAAAGGTGGTGGACGATATCAATGG
                      ____________________________________________________________
consensus TGACAACAATAGCGTAGGAGTTCTTGTAGACCTTGAAAAGGTGGTGGACGATATCAATGG
 
. : . : . : . : . : . :
JMSF022I04+ CGACGACGCTGGCGCTGCAACCCATGCCGGAGAGGTTAAACGTCTTCACGTCCTCCCTCA
                      ____________________________________________________________
consensus CGACGACGCTGGCGCTGCAACCCATGCCGGAGAGGTTAAACGTCTTCACGTCCTCCCTCA
 
. : . : . : . : . : . :
JMFF036K01+ TGTACCGGTTAACGACGCGGGAGGTGAGCGACGGCGCCGACGCCAGCAGCGACACAT
JMSF022I04+ TCTTGTACCGGTTAACGACGCGGGAGGTGAGCGACGGCGCCGACGCCAGCAGCGACACAT
                      ____________________________________________________________
consensus TCTTGTACCGGTTAACGACGCGGGAGGTGAGCGACGGCGCCGACGCCAGCAGCGACACAT
 
. : . : . : . : . : . :
JMFF036K01+ TCACCACCAGAACATCAATCTCCCGCGGCGAAACCTTAGACTTCGCGAACAGATTGTCGA
JMSF022I04+ TCACCACCAGAACATCAATCTCCCGCGGCGAAACCTTAGACTTCGCGAACAGATTGTCGA
                      ____________________________________________________________
consensus TCACCACCAGAACATCAATCTCCCGCGGCGAAACCTTAGACTTCGCGAACAGATTGTCGA
 
. : . : . : . : . : . :
JMFF036K01+ GCGTCTGAAACATGATGTCATCCACCTCCGTGAACGAGTCCTCCAGCGTCGGAGAATCCT
JMSF022I04+ GCGTCTGAAACATGATGTCATCCACCTCCGTGAACGAGTCCTCCAGCGTCGGAGAATCCT
                      ____________________________________________________________
consensus GCGTCTGAAACATGATGTCATCCACCTCCGTGAACGAGTCCTCCAGCGTCGGAGAATCCT
 
. : . : . : . : . : . :
JMFF036K01+ CCCGCCCTTCCAGAACGTTAATCGGAATATATGTCTGCTCGCCGACGCCGGAGTTCACCA
JMSF022I04+ CCCGCCCTTCCAGAACGTTAATCGGAATATATGTCTGCTCGCCGACGCCGGAGTTCACCA
                      ____________________________________________________________
consensus CCCGCCCTTCCAGAACGTTAATCGGAATATATGTCTGCTCGCCGACGCCGGAGTTCACCA
 
. : . : . : . : . : . :
JMFF036K01+ TCGTCTGCAGCAGGAACCGGAACTCGTCGATCCCCAGGTTCCGGTTCCGGTACACCACCA
JMSF022I04+ TCGTCTGCAGCAGGAACCGGAACTCGTCGATCCCCAGGTTCCGGTTCCGGTACACCACCA
                      ____________________________________________________________
consensus TCGTCTGCAGCAGGAACCGGAACTCGTCGATCCCCAGGTTCCGGTTCCGGTACACCACCA
 
. : . : . : . : . : . :
JMFF036K01+ ACGCCGACTTGTCGGTGCTCAGGCGCCGGGCGACGTCCGTCGGCTTGTAGCACTCGTAGT
JMSF022I04+ ACGCCGACTTGTCGGTGCTCAGGCGCCGGGCGACGTCCGTCGGCTTGTAGCACTCGTAGT
                      ____________________________________________________________
consensus ACGCCGACTTGTCGGTGCTCAGGCGCCGGGCGACGTCCGTCGGCTTGTAGCACTCGTAGT
 
. : . : . : . : . : . :
JMFF036K01+ TCAACATGTAACAACATTGGTGTCTCCGGCGAAGATAAGATCGGAGGATGTAAACGACAG
JMSF022I04+ TCAACATGTAACAACATTGGTGTCTCCGGCGAAGATAAGATCGGAGGATGTAAACGACAG
                      ____________________________________________________________
consensus TCAACATGTAACAACATTGGTGTCTCCGGCGAAGATAAGATCGGAGGATGTAAACGACAG
 
. : . : . : . : . : . :
JMFF036K01+ TGTACAGGAAAAGAAGTGAATATATTGCTACCAGGGTTTCCATGTGATAAAATGAACGGC
JMSF022I04+ TGTACAGGAAAAGAAGTGAATATATTGCTACCAGGGTTTCCATGTGATAAAATGAACGGC
                      ____________________________________________________________
consensus TGTACAGGAAAAGAAGTGAATATATTGCTACCAGGGTTTCCATGTGATAAAATGAACGGC
 
. : . : . : . : . : . :
JMFF036K01+ TGAGATCTATTTGTGTGTGTGTGTCTGTATGTATATATGTGTGTGTAGTGTTTGCATGC
JMSF022I04+ TGAGATCTATTTGTGTGTGTGTGTCTGTATGTATATATGTGTGTGTAGTGTTTGCATGCC
                      ____________________________________________________________
consensus TGAGATCTATTTGTGTGTGTGTGTCTGTATGTATATATGTGTGTGTAGTGTTTGCATGCC