Previous Contig 006068:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF020K21Sequence677006068 (2)gb:PDE416708_16995792e-52Populus deltoides MER locus, genomic DNA, cultivar S9-2.723022935
JMSF022H16Sequence651006068 (2)gb:POP490334_17009872e-24Populus balsamifera subsp. trichocarpa mRNA for TIR-NBS disease resistance prote

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF020K21+ GACGGATTGTATCATATAAGGGGAATAATGGAAGAAGAC
                      ____________________________________________________________
consensus GACGGATTGTATCATATAAGGGGAATAATGGAAGAAGAC
 
. : . : . : . : . : . :
JMSF020K21+ AACCAGAAAATGCTACCAAAAAGTTTTAATATTTTTTTTAAAAATAAAAGGGAGAAATCA
                      ____________________________________________________________
consensus AACCAGAAAATGCTACCAAAAAGTTTTAATATTTTTTTTAAAAATAAAAGGGAGAAATCA
 
. : . : . : . : . : . :
JMSF020K21+ AGATACCCATCAGCATCGTTCAGTAAATCCCAACCAGAAAAATTTGCAACCTTGGTCAGA
                      ____________________________________________________________
consensus AGATACCCATCAGCATCGTTCAGTAAATCCCAACCAGAAAAATTTGCAACCTTGGTCAGA
 
. : . : . : . : . : . :
JMSF020K21+ GCTGTTTTCCATTGACTAACTTTTTTGGTCCCAAATCGTTGTTGATGTTGAGCCAAGGCT
                      ____________________________________________________________
consensus GCTGTTTTCCATTGACTAACTTTTTTGGTCCCAAATCGTTGTTGATGTTGAGCCAAGGCT
 
. : . : . : . : . : . :
JMSF020K21+ TCACCAAACTCACCGGTTTGTTTGCGCACTTGAGAAGGATCAACATCATAGAATACAGGG
                      ____________________________________________________________
consensus TCACCAAACTCACCGGTTTGTTTGCGCACTTGAGAAGGATCAACATCATAGAATACAGGG
 
. : . : . : . : . : . :
JMSF020K21+ AGAACCACCTGATTTGCCTTTTCTTTACATTCCACTATCTTCACAAGCTCCTCAAGACAC
JMSF022H16+ TGATTTGCCTTTTCTTTACATTCCACTATCTTCACAAGCTCGTCAAGACAC
                      ____________________________________________________________
consensus AGAACCACCTGATTTGCCTTTTCTTTACATTCCACTATCTTCACAAGCTCGTCAAGACAC
 
. : . : . : . : . : . :
JMSF020K21+ CACCGGGAAGAGGCATGGGTTTTGGAGAACACAATAATGGAGATCTTTGATTCTTGAATA
JMSF022H16+ CACCGGGAAGAGGCATAGGTTTTGGAGAACACAATAATAGAAATCTTTGATTGTTGAATA
                      ____________________________________________________________
consensus CACCGGGAAGAGGCATGGGTTTTGGAGAACACAATAATGGAGATCTTTGATTGTTGAATA
 
. : . : . : . : . : . :
JMSF020K21+ GCTTTGATGAGGTCAGTGGAGATGTCCTCTCCTTTACGGAGCTCTTCTGCATCTCTGAAA
JMSF022H16+ GCTTTGATGAGGTCAGTGGAGATGTCTTCTCCTTTACGGAGCTCTTCTGCATCTCTGAAA
                      ____________________________________________________________
consensus GCTTTGATGAGGTCAGTGGAGATGTCTTCTCCTTTACGGAGCTCTTCTGCATCTCTGAAA
 
. : . : . : . : . : . :
JMSF020K21+ GTGTGAACTCCAACTCGGCACAACGCAGCAAAGAGGTGATCTGTAAAGGATTTTCGTGTG
JMSF022H16+ GTGTGAACTCCTGCTCGGCACAACGCAGCAAAGAGGTGATCTGTAAAAGACTTTCGTGTG
                      ____________________________________________________________
consensus GTGTGAACTCCTGCTCGGCACAACGCAGCAAAGAGGTGATCTGTAAAGGATTTTCGTGTG
 
. : . : . : . : . : . :
JMSF020K21+ TCTTCACCTCTAAAGCTCAAAAAGACATC
JMSF022H16+ TCTTCACCTCTAAAGCTCAAAAAGACATCATAGTCCCAACAGCACGGAAGTGAAGAGGAG
                      ____________________________________________________________
consensus TCTTCACCTCTAAAGCTCAAAAAGACATCATAGTCCCAACAGCACGGAAGTGAAGAGGAG
 
. : . : . : . : . : . :
JMSF022H16+ GATGAGGGAAGGAGCAGTAGTTGATTAGTTTCAGAAGTGGATTCCATGATATGAATATAT
                      ____________________________________________________________
consensus GATGAGGGAAGGAGCAGTAGTTGATTAGTTTCAGAAGTGGATTCCATGATATGAATATAT
 
. : . : . : . : . : . :
JMSF022H16+ GATGGTGGTGGAAACACAGCTAAGGAAGGTAGGAAGGAAGGATGGATGGAGATTAAAGCT
                      ____________________________________________________________
consensus GATGGTGGTGGAAACACAGCTAAGGAAGGTAGGAAGGAAGGATGGATGGAGATTAAAGCT
 
. : . : . : . : . : . :
JMSF022H16+ TAACTTACGATTACTACTGCGTTTAATTGGCTGCTTCTAATTCATGTGGAGGCATTTATA
                      ____________________________________________________________
consensus TAACTTACGATTACTACTGCGTTTAATTGGCTGCTTCTAATTCATGTGGAGGCATTTATA
 
. : . : . : . : . : . :
JMSF022H16+ TTATATATACATCTTCTGATCTCTAAGAAATGGAAATTGCTATGAATTTTCTTGCATCCA
                      ____________________________________________________________
consensus TTATATATACATCTTCTGATCTCTAAGAAATGGAAATTGCTATGAATTTTCTTGCATCCA
 
. : . : . : . : . : . :
JMSF022H16+ CTTCCATTTTTAATAAAGATGTAGGCCGGGCAGAGCATTAAATAAAACAATAATAGAGTT
                      ____________________________________________________________
consensus CTTCCATTTTTAATAAAGATGTAGGCCGGGCAGAGCATTAAATAAAACAATAATAGAGTT
 
. : . : . : . : . : . :
JMSF022H16+ TTGTGGGTGTTTGATCGAGTGGCACCTTTTGGTTTGACAAAACGAATTGAAGCAATTGTC
                      ____________________________________________________________
consensus TTGTGGGTGTTTGATCGAGTGGCACCTTTTGGTTTGACAAAACGAATTGAAGCAATTGTC