Previous Contig 006065:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF022H03Sequence687006065 (2)gb:AP003022_18242985e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P068
JMSF036K10Sequence712006065 (2)gb:AP003022_18242982e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P068697013051 (4)gb:AY359966_16020337e-23Lycopersicon esculentum EIX receptor 2 (Eix2) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036K10+ AGAGATGNAGGAAGTAGCTTGGTTTAGCCACA
                      ____________________________________________________________
consensus AGAGATGNAGGAAGTAGCTTGGTTTAGCCACA
 
. : . : . : . : . : . :
JMSF036K10+ AATTCAGTAGGGGAAAAGTTGCTATATTTCCATACTGTAAAGACAAGTGTTGTAGGAAAC
                      ____________________________________________________________
consensus AATTCAGTAGGGGAAAAGTTGCTATATTTCCATACTGTAAAGACAAGTGTTGTAGGAAAC
 
. : . : . : . : . : . :
JMSF036K10+ TAGAAGAGTTGATGTGCAAAAGTGATGATGAGGGACTTGGAAGGTAGCAGGAAGATAGGC
                      ____________________________________________________________
consensus TAGAAGAGTTGATGTGCAAAAGTGATGATGAGGGACTTGGAAGGTAGCAGGAAGATAGGC
 
. : . : . : . : . : . :
JMSF036K10+ TTAGTGTTCTCAGAAAAGAAAGCTTAGAAATTGAGTGAAGCCAATCTGAAACAGAATGAA
JMSF022H03+ AGTGAAGCCAATCTGAAACAGAATGAA
                      ____________________________________________________________
consensus TTAGTGTTCTCAGAAAAGAAAGCTTAGAAATTGAGTGAAGCCAATCTGAAACAGAATGAA
 
. : . : . : . : . : . :
JMSF036K10+ GGTCTACGCAATCCATATTGAGATACTCCAAGGAAGAAAGATGAGAAATCCATTCCAAGG
JMSF022H03+ GGTCTACGCAATCCATATTGAGATACTCCAAGGAAGAAAGATGAGAAATCCATTCCAAGG
                      ____________________________________________________________
consensus GGTCTACGCAATCCATATTGAGATACTCCAAGGAAGAAAGATGAGAAATCCATTCCAAGG
 
. : . : . : . : . : . :
JMSF036K10+ TGTCAACCACTTTTAAACGTTGACCATAAAAGTTGTTGCCAATGTCAAGATATTTCAAAG
JMSF022H03+ TGTCAACCACTTTTAAACGTTGACCATAAAAGTTGTTGCCAATGTCAAGATATTTCAAAG
                      ____________________________________________________________
consensus TGTCAACCACTTTTAAACGTTGACCATAAAAGTTGTTGCCAATGTCAAGATATTTCAAAG
 
. : . : . : . : . : . :
JMSF036K10+ TGGAAATATTTCCCAGATGAGGAGGAACATTCCCAACAAATTTATTATAAGAAAGATTAA
JMSF022H03+ TGGAAATATTTCCCAGATGAGGAGGAACATTCCCAACAAATTTATTATAAGAAAGATTAA
                      ____________________________________________________________
consensus TGGAAATATTTCCCAGATGAGGAGGAACATTCCCAACAAATTTATTATAAGAAAGATTAA
 
. : . : . : . : . : . :
JMSF036K10+ GATAGACCAAGTTGTTGAGAGAGCCAATGAAACTTGGAATTCTATCAAATTTATTGAAAC
JMSF022H03+ GATAGACCAAGTTGTTGAGAGAGCCAATGAAACTTGGAATTCTATCAAATTTATTGAAAC
                      ____________________________________________________________
consensus GATAGACCAAGTTGTTGAGAGAGCCAATGAAACTTGGAATTCTATCAAATTTATTGAAAC
 
. : . : . : . : . : . :
JMSF036K10+ TAAGATCCAAGAAATTGAGAAAGGGTAAATGAAGCAAGGAAGGGCTGATTTCACCTTGAA
JMSF022H03+ TAAGATCCAAGAAATTGAGAAAGGGTAAATGAAGCAAGGAAGGGCTGATTTCACCTTGAA
                      ____________________________________________________________
consensus TAAGATCCAAGAAATTGAGAAAGGGTAAATGAAGCAAGGAAGGGCTGATTTCACCTTGAA
 
. : . : . : . : . : . :
JMSF036K10+ AGCCTGGGTTGTAGCATGGTGATCCATCAGTGCACAAGCCTTGACGCCCCAAATGAAGAG
JMSF022H03+ AGCCTGGGTTGTAGCATGGTGATCCATCAGTGCACAAGCCTTGACGCCCCAAATGAAGAG
                      ____________________________________________________________
consensus AGCCTGGGTTGTAGCATGGTGATCCATCAGTGCACAAGCCTTGACGCCCCAAATGAAGAG
 
. : . : . : . : . : . :
JMSF036K10+ CAACAACATGGGCAGTAGTTGTGTTATCACAACCAACTCCTTTCCATTTGCAGCAGTCAT
JMSF022H03+ CAACAACATGGGCAGTAGTTGTGTTATCACAACCAACTCCTTTCCATTTGCAGCAGTCAT
                      ____________________________________________________________
consensus CAACAACATGGGCAGTAGTTGTGTTATCACAACCAACTCCTTTCCATTTGCAGCAGTCAT
 
. : . : . : . : . : . :
JMSF036K10+ CATCATCTCCCCATGAGGAAAGAGAGCTTAATGGGTCAGAAATAATGCTATGTTTGAAGC
JMSF022H03+ CATCATCTCCCCATGAGGAAAGAGAGCTTAATGGGTCAGAAATAATGCTATGTTTGAAGC
                      ____________________________________________________________
consensus CATCATCTCCCCATGAGGAAAGAGAGCTTAATGGGTCAGAAATAATGCTATGTTTGAAGC
 
. : . : . : . : . : . :
JMSF036K10+ TTAGAAGAGCTTTTCTCTC
JMSF022H03+ TTAGAAGAGCTTTTCTCTCATTCTCAAAGCAGCTCCTACTCCCATTTAAATATTGAAGAA
                      ____________________________________________________________
consensus TTAGAAGAGCTTTTCTCTCATTCTCAAAGCAGCTCCTACTCCCATTTAAATATTGAAGAA
 
. : . : . : . : . : . :
JMSF022H03+ TAATCAAAAGGAACAGAAGCCACTGAAGATAAGAACCACTAATCCTCATCATCGACTTTA
                      ____________________________________________________________
consensus TAATCAAAAGGAACAGAAGCCACTGAAGATAAGAACCACTAATCCTCATCATCGACTTTA
 
. : . : . : . : . : . :
JMSF022H03+ ATTGGATTCAAGACAATTGATTTAGCAATATTATGTGTAAGTTTTGTTGTATGCTTTACC
                      ____________________________________________________________
consensus ATTGGATTCAAGACAATTGATTTAGCAATATTATGTGTAAGTTTTGTTGTATGCTTTACC