Previous Contig 006052:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007D16Sequence574006052 (5)gb:BT015349_16421779e-40Arabidopsis thaliana At3g16110 gene, complete cds.>gb:BT015798_1642416 Arabidops759008486 (2)gb:BT015349_16421771e-70Arabidopsis thaliana At3g16110 gene, complete cds.>gb:BT015798_1642416 Arabidops
JMSF019M17Sequence433006052 (5)gb:BT015349_16421771e-04Arabidopsis thaliana At3g16110 gene, complete cds.>gb:BT015798_1642416 Arabidops707006052 (5)gb:AB026295_15169483e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0681F10
JMSF022E08Sequence670006052 (5)gb:AP003434_18293192e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045724006052 (5)gb:AB026295_15169488e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0681F10

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019M17- CCATCTTCAATAGTGATGACCATTTCTATCGTCATAAAATAAATGATACCTCAAAGATT
rJMSF022E08- AATGATACCTCAAAGATT
                      ____________________________________________________________
consensus CCATCTTCAATAGTGATGACCATTTCTATCGTCATAAAATAAATGATACCTCAAAGATT
 
. : . : . : . : . : . :
rJMSF019M17- AAACATCCTTTGTAACAAAAACAACTTCTATAGAAATTTGAATAAAAATGTCCCACAAAT
rJMSF022E08- AAACATCCTTTGTAACAAAAACAACTTCTATAGAAATTTGAATAAAAATGTCCCACAAAT
                      ____________________________________________________________
consensus AAACATCCTTTGTAACAAAAACAACTTCTATAGAAATTTGAATAAAAATGTCCCACAAAT
 
. : . : . : . : . : . :
rJMSF019M17- TAAAACATCATATCATTTCTAGGAAAAAAAAAACTTCATTAATTGATGGAGGACGACTAA
rJMSF022E08- TAAAACATCATATCATTTCTAGGAAAAAAAAAACTTCATTAATTGATGGAGGACGACTAA
                      ____________________________________________________________
consensus TAAAACATCATATCATTTCTAGGAAAAAAAAAACTTCATTAATTGATGGAGGACGACTAA
 
. : . : . : . : . : . :
rJMSF019M17- GTGTAAGCACATGAANGTTTCTTGAACTTGATCGGCTTATTGCTAAAGGAGTCAATGATG
rJMSF022E08- GTGTAAGCACATGAANGTTTCTTGAACTTGATCGGCTTATTGCTAAAGGAGTCAATGATG
                      ____________________________________________________________
consensus GTGTAAGCACATGAANGTTTCTTGAACTTGATCGGCTTATTGCTAAAGGAGTCAATGATG
 
. : . : . : . : . : . :
rJMSF019M17- AACTCACACCATATCTTTCTCCGGNGCTCCGTCCTAAATAATTTCCCCACCATGTCTCCC
rJMSF022E08- AACTCACACCATATCTTTCTCCGGNGCTCCGTCCTAAATAATTTCCCCACCATGTCTCCC
                      ____________________________________________________________
consensus AACTCACACCATATCTTTCTCCGGNGCTCCGTCCTAAATAATTTCCCCACCATGTCTCCC
 
. : . : . : . : . : . :
rJMSF019M17- TGAGACTTCACCTCAAAATTCAGCACCAANGGAACTTGATAACCTACTGTGCCGTCCTTG
rJMSF022E08- TGANACTTCACCTCAAAATTCAGCACCAANGGAACTTGATAACCTACTGNGCCGTCCTTG
                      ____________________________________________________________
consensus TGAGACTTCACCTCAAAATTCAGCACCAANGGAACTTGATAACCTACTGTGCCGTCCTTG
 
. : . : . : . : . : . :
rJMSF019M17- TTTTTGGTTGTCGTCAGACTCGATCCTGCCCCGTACAAGGGGACTTTAGTTCCTTGTATG
rJMSF022E08- TTTTTGGTTGTCGTCAGACTCGATCCTGCCCCGTACAAGGGGACTTTAGTTCCTTGTATG
                      ____________________________________________________________
consensus TTTTTGGTTGTCGTCAGACTCGATCCTGCCCCGTACAAGGGGACTTTAGTTCCTTGTATG
 
. : . : . : . : . : . :
rJMSF019M17- TTCACCATCACTGTTCGACGACTTTTCTTAGGTTGATAATACTTCTTCAACTGGCCAGNG
rJMSF022E08- TTCACCATCACTGTTCGACGACTTTTCTTAGGTTGATAATACTTCTTCAACTGGCCAGNG
JMSF022E08+ CTGGCCAGTG
                      ____________________________________________________________
consensus TTCACCATCACTGTTCGACGACTTTTCTTAGGTTGATAATACTTCTTCAACTGGCCAGTG
 
. : . : . : . : . : . :
rJMSF019M17- GCGACAGTGATGTTGGAGAAGACAAGATTGATGGGTGTAGAGCTAACATGGATGCCGTAG
rJMSF022E08- GCGACAGTGATGTTGGAGAANACAAGATTGATGGGNGTAGAGCTAACATGGATGCCGTAA
JMSF022E08+ GCGACAGTGATGTTGGAGAAGACAAGATTGATGGGTGTAGAGCTAACATGGATGCCGTAG
                      ____________________________________________________________
consensus GCGACAGTGATGTTGGAGAAGACAAGATTGATGGGTGTAGAGCTAACATGGATGCCGTAG
 
. : . : . : . : . : . :
rJMSF019M17- AATGTTGCAGGGTTGTACACGCCTATCCTCAATGACCCGTTCACCGACAGAAACTTTGTG
rJMSF022E08- AATGTTGCAGGGTTGTACACGCCTATCCTCAATGACCCGTTCACCGACAGAAACTTTGTG
JMSF022E08+ AATGTTGCAGGGTTGTACACGCCTATCCTCAATGACCCGTTCACCGACAGAAACTTTGTG
                      ____________________________________________________________
consensus AATGTTGCAGGGTTGTACACGCCTATCCTCAATGACCCGTTCACCGACAGAAACTTTGTG
 
. : . : . : . : . : . :
rJMSF019M17- GGTACACCCGTGAAGTCAGAGCCCTCACCAATAGATATGTTAATCTCTGAGAAGCTCTTG
rJMSF022E08- GGTACACCCGTGAAGTCAGAGCCCTCACCAATAGATATGTTAATCTCTGAGAAGCTCTTG
JMSF022E08+ GGTACACCCGTGAAGTCAGAGCCCTCACCAATAGATATGTTAATCTCTGAGAAGCTCTTG
                      ____________________________________________________________
consensus GGTACACCCGTGAAGTCAGAGCCCTCACCAATAGATATGTTAATCTCTGAGAAGCTCTTG
 
. : . : . : . : . : . :
rJMSF019M17- AGAGTAATCTGAAAATTTCCAGTTGCCTCATTAATTGAATTAATCCTA
rJMSF022E08- AGAGTAATCTGAAAATTTCCAGTTGCCTCATTAATTGAATTAATCCTAAAAACAGGTGCA
JMSF022E08+ AGAGTAATCTGAAAATTTCCAGTTGCCTCATTAATTGAATTAATCCTAAGAACAGGTGCA
                      ____________________________________________________________
consensus AGAGTAATCTGAAAATTTCCAGTTGCCTCATTAATTGAATTAATCCTAAGAACAGGTGCA
 
. : . : . : . : . : . :
rJMSF022E08- CCCGTCTTCTTCTTTCTCCAAATCACAATTTCTTG
JMSF019M17+ CATCAATGGCACTC
JMFF007D16+ CATCAATGGCACGC
JMSF022E08+ CCCGTCTTCTTCTTTCTCCAAATCACAATTTCTTGATTCTTTGCCTCATCAATGGCACTC
                      ____________________________________________________________
consensus CCCGTCTTCTTCTTTCTCCAAATCACAATTTCTTGATTCTTTGCCTCATCAATGGCACTC
 
. : . : . : . : . : . :
JMSF019M17+ TTGGTGTTATCACTGTTAAGCTCAAGCACAATTCTATGAGCTCTGCTCAATAGCTCAGCC
JMFF007D16+ TTGGCGTTATCACTATTAAGCTCAAGCACAATTCTCTGAGCTCTGCTCAATAGCTCAGCC
JMSF022E08+ TTGGTGTTATCACTGTTAAGCTCAAGCACAATTCTATGAGCTCTGCTCAATAGCTCAGCC
                      ____________________________________________________________
consensus TTGGTGTTATCACTGTTAAGCTCAAGCACAATTCTATGAGCTCTGCTCAATAGCTCAGCC
 
. : . : . : . : . : . :
JMSF019M17+ CCAGATGGCTTATCTTTGCTCTCATGACGACCCCCTTCTGAACTCAAATCAGCTTCTTCG
JMFF007D16+ CCAGATGGCTTATCTTTGCTCTCATGACGACCCCCTTCTGAACTCAAATCAGCTTCTTCG
JMSF022E08+ CCAGATGGCTTATCTTTGCTCTCATGACGACCCCCTTCTGAACTCAAATCAGCTTCTTCG
                      ____________________________________________________________
consensus CCAGATGGCTTATCTTTGCTCTCATGACGACCCCCTTCTGAACTCAAATCAGCTTCTTCG
 
. : . : . : . : . : . :
JMSF019M17+ TCTAGTGCTATCAGTTCTTGAAGATCCCCCAGGTCGCCACTATCCTCATCGGGTGCCGTG
JMFF007D16+ TCTAGTGCTATCAGTTCTTGAAGATCCCCCAGGTCGTCAATATCCTCATCGGGTGCCGTG
JMSF022E08+ TCTAGTGCTATCAGTTCTTGAAGATCCCCCAGGTCGCCACTATCCTCATCGGGTGCCGTG
                      ____________________________________________________________
consensus TCTAGTGCTATCAGTTCTTGAAGATCCCCCAGGTCGCCACTATCCTCATCGGGTGCCGTG
 
. : . : . : . : . : . :
JMSF019M17+ GGCTCGGAAGATAGTGAAGTGGCGGTAAAAATGGCGAGTAGGAGAAGGAGGAGTAGGGAG
JMFF007D16+ GGCTCGGAAGAGAGTGAAATGGCGGTAAAAATGGCGAGTAGGAGAAGGAGGAGTAGGGAG
JMSF022E08+ GGCTCGGAAGATAGTGAAGTGGCGGTAAAAATGGCGAGTAGGAGAAGGAGGAGTAGGGAG
                      ____________________________________________________________
consensus GGCTCGGAAGATAGTGAAGTGGCGGTAAAAATGGCGAGTAGGAGAAGGAGGAGTAGGGAG
 
. : . : . : . : . : . :
JMSF019M17+ AAAAAGACAGATCTTGAAGTGGGTTTTGCAGTAAACATGGTGAATTGGAATGAAGTGAGA
JMFF007D16+ AAAAAGACAGATCTTGAAGTGGGTTTTGCAGTAAACATGGTGAATTGGAGTGGAGTGAGA
JMSF022E08+ AAAAAGACAGATCTTGAAGTGGGTTTTGCAGTAAACATGGTGAATTGGAATGAAGTGAGA
                      ____________________________________________________________
consensus AAAAAGACAGATCTTGAAGTGGGTTTTGCAGTAAACATGGTGAATTGGAATGAAGTGAGA
 
. : . : . : . : . : . :
JMSF019M17+ TCTGTTTGCAGTTTGCTCAAAGAGTGAAGGAAATGTCGCAACCTGCAATGGTAG
JMFF007D16+ TCTGTTTGCAGTTTGATCAAAGAGTGAAGGAAATGT
JMSF022E08+ TCTGTTTGCAGTTTGCTCAAAGAGTGAAGGAAATGTCGCAACCTGCAATGGTAGTTCGTC
                      ____________________________________________________________
consensus TCTGTTTGCAGTTTGCTCAAAGAGTGAAGGAAATGTCGCAACCTGCAATGGTAGTTCGTC