Previous Contig 006042:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF022B07Sequence583006042 (2)pir|S48690|S486907e-30ubiquinol-cytochrome-c reductase (EC 1.10.2.2) 11K protein - potato>gb:STCR7_172522006042 (2)pir|S48690|S486905e-30ubiquinol-cytochrome-c reductase (EC 1.10.2.2) 11K protein - potato>gb:STCR7_172

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022B07- GGCGTTAGGTAAGCTCCATTCCTCGCTTCGTTCTCATCATCAG
                      ____________________________________________________________
consensus GGCGTTAGGTAAGCTCCATTCCTCGCTTCGTTCTCATCATCAG
 
. : . : . : . : . : . :
JMSF022B07- ATCCGTATTCAACAATCTTCTGCTCCGATCTACTTTTATACGGCCATCAACCCCTTACTT
                      ____________________________________________________________
consensus ATCCGTATTCAACAATCTTCTGCTCCGATCTACTTTTATACGGCCATCAACCCCTTACTT
 
. : . : . : . : . : . :
rJMSF022B07+ ATCTCCATTCGACATGTCGGACGAGGAAGTTGTAGATCAGAAGAAGTTATATGA
JMSF022B07- TTGTTTATCTCCATTCGACATGTCGGACGAGGAAGTTGTAGATCAGAAGAAGTTATATGA
                      ____________________________________________________________
consensus TTGTTTATCTCCATTCGACATGTCGGACGAGGAAGTTGTAGATCAGAAGAAGTTATATGA
 
. : . : . : . : . : . :
rJMSF022B07+ AGATTCTTGTAAGCCAAAATGTGTGAGGCAACTTAAAGAGTATCAGGCATGTGCTAAAAG
JMSF022B07- AGATTCTTGTAAGCCAAAATGTGTGAGGCAACTTAAAGAGTATCAGGCATGTGCTAAAAG
                      ____________________________________________________________
consensus AGATTCTTGTAAGCCAAAATGTGTGAGGCAACTTAAAGAGTATCAGGCATGTGCTAAAAG
 
. : . : . : . : . : . :
rJMSF022B07+ AGTTGATGGCGATGAAAGTGGGCACAAGCATTGCACTGGCCAATATTTCGACTATTGGCA
JMSF022B07- AGTTGATGGCGATGAAAGTGGGCACAAGCATTGCACTGGCCAATATTTCGACTATTGGCA
                      ____________________________________________________________
consensus AGTTGATGGCGATGAAAGTGGGCACAAGCATTGCACTGGCCAATATTTCGACTATTGGCA
 
. : . : . : . : . : . :
rJMSF022B07+ CTGCATTGACAAATGTGTTGC
JMSF022B07- CTGCATTGACAAATGTGTTGCTCCGAAGCTATTTACAAAACTCAAGTAACGGGCCTGCAT
                      ____________________________________________________________
consensus CTGCATTGACAAATGTGTTGCTCCGAAGCTATTTACAAAACTCAAGTAACGGGCCTGCAT
 
. : . : . : . : . : . :
JMSF022B07- TGCATCTCGCTACTTCATTTCTCAACATAGCCTTTATTACGTGTTCTTTGTGCATGTCTT
                      ____________________________________________________________
consensus TGCATCTCGCTACTTCATTTCTCAACATAGCCTTTATTACGTGTTCTTTGTGCATGTCTT
 
. : . : . : . : . : . :
JMSF022B07- TGCTAGAAGCTACCGATTCCTCAGCGCAACGTTGTAGCTGCATCGAAATTTTTGAACTGC
                      ____________________________________________________________
consensus TGCTAGAAGCTACCGATTCCTCAGCGCAACGTTGTAGCTGCATCGAAATTTTTGAACTGC
 
. : . : . : . : . : . :
JMSF022B07- AATGATCTTGAATTTGATTAATAAGAGATCATACTTGTTTGATAAAATCTGTTACTCTTT
                      ____________________________________________________________
consensus AATGATCTTGAATTTGATTAATAAGAGATCATACTTGTTTGATAAAATCTGTTACTCTTT
 
. : . : . : . : . : . :
JMSF022B07- GGTTTAAATGATTATGTGATTATCAAAGATGTTTGTTTGATACAAAAAAGAAAAAAAAAA
                      ____________________________________________________________
consensus GGTTTAAATGATTATGTGATTATCAAAGATGTTTGTTTGATACAAAAAAGAAAAAAAAAA