Previous Contig 006041:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011A09Sequence518006041 (3)gb:AC091774_17350491e-11Oryza sativa chromosome 6 BAC OJ1540_H01 genomic sequence, complete sequence.>gb711008689 (4)pir|T51100|T511001e-55protein phosphatase 2C homolog [imported] - common ice plant>gb:AF097667_1767893
JMFF048I05Sequence539006041 (3)pir|T51100|T511003e-45protein phosphatase 2C homolog [imported] - common ice plant>gb:AF097667_1767893
JMSF022B03Sequence686006041 (3)pir|T51100|T511009e-28protein phosphatase 2C homolog [imported] - common ice plant>gb:AF097667_1767893770008689 (4)pir|T51100|T511005e-79protein phosphatase 2C homolog [imported] - common ice plant>gb:AF097667_1767893

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF048I05+ AGTCATAGAGTTT
                      ____________________________________________________________
consensus AGTCATAGAGTTT
 
. : . : . : . : . : . :
JMFF048I05+ TGCTCGGTGGGGAACCTCTGGAGATGCTGAAAGAGGGGATCATTGATAAACCGTGAGGTC
                      ____________________________________________________________
consensus TGCTCGGTGGGGAACCTCTGGAGATGCTGAAAGAGGGGATCATTGATAAACCGTGAGGTC
 
. : . : . : . : . : . :
JMFF048I05+ TCCGGCCCACCATGACCATCATATACTCCAACAAAAGTCCCATAAGGACCAGAATCAAGT
JMSF022B03+ AAGTCCCATAAGGACCAGAATCAAGT
                      ____________________________________________________________
consensus TCCGGCCCACCATGACCATCATATACTCCAACAAAAGTCCCATAAGGACCAGAATCAAGT
 
. : . : . : . : . : . :
JMFF048I05+ AAGCTCAAAGATCCAGACTCAATCTGGCTTGGATCCTCAAGCAAATTGTTTGCCTGGACA
JMSF022B03+ AAGCTCAAAGATCCAGACTCAATCTGGCTTTGATCCTCAAGCAAATTGTTTGCCTGGACA
                      ____________________________________________________________
consensus AAGCTCAAAGATCCAGACTCAATCTGGCTTTGATCCTCAAGCAAATTGTTTGCCTGGACA
 
. : . : . : . : . : . :
JMFF048I05+ ACAGCCATTGAGAAATCACCAAGCAAGTGCTGCCCAATGTCCTTATACCAAAGAAGTCCA
JMSF022B03+ ACAGCCATTGAGAAATCACCAAGCAAGTGCTGCCCAATGTCCTTATACCAAAGAAGTCCA
                      ____________________________________________________________
consensus ACAGCCATTGAGAAATCACCAAGCAAGTGCTGCCCAATGTCCTTATACCAAAGAAGTCCA
 
. : . : . : . : . : . :
JMFF048I05+ TCCTGCCGGCAAGTAGCATCGAAACCCTTACGGACGTGGCTGTTGGATGATGAGCGCCAA
JMSF022B03+ TCCTGCCGGCAAGTAGCATCGAAACCCTTACGGACGTGGCTGTTGGATGATGAGCGCCAA
                      ____________________________________________________________
consensus TCCTGCCGGCAAGTAGCATCGAAACCCTTACGGACGTGGCTGTTGGATGATGAGCGCCAA
 
. : . : . : . : . : . :
JMFF048I05+ CAGGTCTTCAGGAAATTTATCAACCTTGATAACATGCCTCATTTCATCCCGGCTTACTGA
JMSF022B03+ CAGGTCTTCAGGAAATTTATCAACCTTGATAACATGCCTCATTTCATCCCGGCTTACTGA
                      ____________________________________________________________
consensus CAGGTCTTCAGGAAATTTATCAACCTTGATAACATGCCTCATTTCATCCCGGCTTACTGA
 
. : . : . : . : . : . :
JMFF048I05+ CAAATCTACAACATCCAAAATGGATGCAAGAGCGCTCCAACTAAAAGCCCCTCACAACCA
JMSF022B03+ CAAATCTACAACATCCAAAATGGATGCAAGAGCGCTCCAACTAAAAGCCCCTCACAACCA
                      ____________________________________________________________
consensus CAAATCTACAACATCCAAAATGGATGCAAGAGCGCTCCAACTAAAAGCCCCTCACAACCA
 
. : . : . : . : . : . :
JMFF048I05+ ATCTCTCTCAGAGTGGAGTTTGTGGGGTGCTTTTATGCTGTTTGCTGGTCGCTGACTGAA
JMFF011A09+ CTCAGAGTGGAGTTTGTGGGGTGCTTTTATGCTGTTTGCTGGTCGCTGACTGAA
JMSF022B03+ ATCTCTCTCAGAGTGGAGTTTGTGGGGTGCTTTTATGCTGTTTGCTGGTCGCTGACTGAA
                      ____________________________________________________________
consensus ATCTCTCTCAGAGTGGAGTTTGTGGGGTGCTTTTATGCTGTTTGCTGGTCGCTGACTGAA
 
. : . : . : . : . : . :
JMFF048I05+ CCCTGACAACTGAAAACGACTGAGATCCGAATCAAAAATTACCAAT
JMFF011A09+ CCCTGACAACTGAAAACGACTGAGATCCGAATCAAAAATTAGCAATCTCAAAGCGTTAGA
JMSF022B03+ CCCTGACAACTGAAAACGACTGAGATCCGAATCAAAAATTAGCAATCTCAAAGCGTTAGA
                      ____________________________________________________________
consensus CCCTGACAACTGAAAACGACTGAGATCCGAATCAAAAATTAGCAATCTCAAAGCGTTAGA
 
. : . : . : . : . : . :
JMFF011A09+ TCTATAAAGAAGCCATCAAATCGCCCCTTCCTTCATACACACTGAAGAAAATACGTTAAA
JMSF022B03+ TCTATGAAGAAGCCATCAAATCGCCCCTTCCTTCATACACACTGAAGAAAATACGTTAAA
                      ____________________________________________________________
consensus TCTATGAAGAAGCCATCAAATCGCCCCTTCCTTCATACACACTGAAGAAAATACGTTAAA
 
. : . : . : . : . : . :
JMFF011A09+ TTTAACTTCCTTTTCAGGTCTTACTTTCTCTAATTCTGATTTTTGCTCAAAATAAGAGAA
JMSF022B03+ TTTAACTTCCTTTTCAGGTCTTACTTTCTCTAATTCTGATTTTTGCTCAAAATAAGAGAA
                      ____________________________________________________________
consensus TTTAACTTCCTTTTCAGGTCTTACTTTCTCTAATTCTGATTTTTGCTCAAAATAAGAGAA
 
. : . : . : . : . : . :
JMFF011A09+ GGGGGAGAAAGGAAGAAAGCTTCACGAATTGAACAAACTGATGAAC
JMSF022B03+ GGGGGAGAAAGGAAGAAAGCTTCACGAATTGAACAAACTGATGAACAACTCTCTTCTATT
                      ____________________________________________________________
consensus GGGGGAGAAAGGAAGAAAGCTTCACGAATTGAACAAACTGATGAACAACTCTCTTCTATT
 
. : . : . : . : . : . :
JMSF022B03+ CCTTTTTTCTTCCCTTTTTTGTGTATCTTCGTGGAATAACTGGCAAAAGCCTAATCGCCC
                      ____________________________________________________________
consensus CCTTTTTTCTTCCCTTTTTTGTGTATCTTCGTGGAATAACTGGCAAAAGCCTAATCGCCC