Previous Contig 006039:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047H09Sequence626006039 (5)gb:AY120739_15796212e-36Arabidopsis thaliana unknown protein (At2g18900) mRNA, complete cds.574010736 (2)gb:AY120739_15796212e-09Arabidopsis thaliana unknown protein (At2g18900) mRNA, complete cds.
JMFS019D03Sequence627006039 (5)gb:AY120739_15796216e-39Arabidopsis thaliana unknown protein (At2g18900) mRNA, complete cds.
JMFS055H04Sequence642006039 (5)gb:AY120739_15796212e-37Arabidopsis thaliana unknown protein (At2g18900) mRNA, complete cds.
JMFS126H11Sequence623006039 (5)gb:AY120739_15796219e-37Arabidopsis thaliana unknown protein (At2g18900) mRNA, complete cds.
JMSF022A07Sequence624006039 (5)gb:AY120739_15796211e-37Arabidopsis thaliana unknown protein (At2g18900) mRNA, complete cds.770010736 (2)gb:AY120739_15796216e-26Arabidopsis thaliana unknown protein (At2g18900) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS019D03+ TGTTGAAATGTCCTGAGAAGAAATAT
JMFF047H09+ AGAAGAAATAT
JMFS055H04+ AGAAGAAATAT
                      ____________________________________________________________
consensus TGTTGAAATGTCCTGAGAAGAAATAT
 
. : . : . : . : . : . :
JMFS019D03+ AAGCAAAAACATCCATAGATTTTTCACTGCTCT-CCAGTGGTTGACATACTAGTCCTGGA
JMFF047H09+ AAGCAAAAACATCCATAGATT-TTCACTGCTCTCCCAGTGGTGNACATACTAGTCCTGGA
JMFS055H04+ AAGCAAAAACATCCATAGATTTTTCACTGCTCT-CCAGTGGTTGACATACTAGTCCTGGA
JMFS126H11+ CATCCATAGATTNTTCACTGCTCT-CCAGTGGTTGACATACTAGTCCTGGA
JMSF022A07+ AGTGGTTGACATACTAGTCCTGGA
                      ____________________________________________________________
consensus AAGCAAAAACATCCATAGATTTTTCACTGCTCT-CCAGTGGTTGACATACTAGTCCTGGA
 
. : . : . : . : . : . :
JMFS019D03+ ATCACCATGGAATGAATTGGGGTCTTAATATTAATAGTCTTCATCAATTCAGCTACTGAA
JMFF047H09+ ATCACCATGGAATGAATTGGGGTCTTAATATTAATAGTCTTCATCAATTCAGCTACTGAA
JMFS055H04+ ATCACCATGGAATGAATTGGGGTCTTAATATTAATAGTCTTCATCAATTCAGCTACTGAA
JMFS126H11+ ATCACCATGGAATGAATTGGGGTCTTAATATTAATAGTCTTCATCAATTCAGCTACTGAA
JMSF022A07+ ATCACCATGGAATGAATTGGGGTCTTAATATTAATAGTCTTCATCAATTCAGCTACTGAA
                      ____________________________________________________________
consensus ATCACCATGGAATGAATTGGGGTCTTAATATTAATAGTCTTCATCAATTCAGCTACTGAA
 
. : . : . : . : . : . :
JMFS019D03+ AAGTCCCAATATCTAATTGTGCCATCAAGTGATGCTGTCCAACAATAGCACAGTATTTTA
JMFF047H09+ AAGTCCCAATATCTAATTGTGCCATCAAGTGATGCTGTCCAACAATAGCACAGTATTTTA
JMFS055H04+ AAGTCCCAATATCTAATTGTGCCATCAAGTGATGCTGTCCAACAATAGCACAGTATTTTA
JMFS126H11+ AAGTCCCAATATCTAATTGTGCCATCAAGTGATGCTGTCCAACAATAGCACAGTATTTTA
JMSF022A07+ AAGTCCCAATATCTAATTGTGCCATCAAGTGATGCTGTCCAACAATAGCNCAGTATTTTA
                      ____________________________________________________________
consensus AAGTCCCAATATCTAATTGTGCCATCAAGTGATGCTGTCCAACAATAGCACAGTATTTTA
 
. : . : . : . : . : . :
JMFS019D03+ CTTGCTGGTGTTGTTGCTGGCACTACAATAACTGATGTTACCAGTGCTGTATGACCTTCC
JMFF047H09+ CTTGCTGGTGTTGTTGCTGGCACTACAATAACTGATGTTACCAGTGCTGTATGACCTTCC
JMFS055H04+ CTTGCTGGTGTTGTTGCTGGCACTACAATAACTGATGTTACCAGTGCTGTATGACCTTCC
JMFS126H11+ CTTGCTGGTGTTGTTGCTGGCACTACAATAACTGATGTTACCAGTGCTGTATGACCTTCC
JMSF022A07+ CTTGCTGGTGTTGTTGCTGGCACTACAATAACTGATGTTACCAGTGCTGTATGACCTTCC
                      ____________________________________________________________
consensus CTTGCTGGTGTTGTTGCTGGCACTACAATAACTGATGTTACCAGTGCTGTATGACCTTCC
 
. : . : . : . : . : . :
JMFS019D03+ AACTCACCTATCTGTAAACCAGTGAAGGTGCTGAAAACAGACACAGTGCTAGCTGTGCAG
JMFF047H09+ AACTCACCTATCTGTAAACCAGTGAAGGTGCTGAAAACAGACACAGTGCTAGCTGTGCAG
JMFS055H04+ AACTCACCTATCTGTAAACCAGTGAAGGTGCTGAAAACAGACACAGTGCTAGCTGTGCAG
JMFS126H11+ AACTCACCTATCTGTAAACCAGTGAAGGTGCTGAAAACAGACACAGTGCTAGCTGTGCAG
JMSF022A07+ AACTCACCTATCTGTAAACCAGNGAAGGTGCTGAAAACAGACACAGTGCTAGCTGTGCAG
                      ____________________________________________________________
consensus AACTCACCTATCTGTAAACCAGTGAAGGTGCTGAAAACAGACACAGTGCTAGCTGTGCAG
 
. : . : . : . : . : . :
JMFS019D03+ ACAAGGAGCTTCTTCCCATCATTTGAGAATGCCGGTGGTGAAGAAACCAGGCTTCTTCCA
JMFF047H09+ ACAAGGAGCTTCTTCCCATCATTTGAGAATGCCGGTGGTGAAGAAACCAGGCTTCTTCCA
JMFS055H04+ ACAAGGAGCTTCTTCCCATCATTTGAGAATGCCGGTGGTGAAGAAACCAGGCTTCTTCCA
JMFS126H11+ ACAAGGAGCTTCTTCCCATCATTTGAGAATGCCGGTGGTGAAGAAACCAGGCTTCTTCCA
JMSF022A07+ ACAAGGAGCTTNTTCCCATCATTTGAGAATGCCGGTGGNGAAGAAACCAGGCTTNTTCCA
                      ____________________________________________________________
consensus ACAAGGAGCTTCTTCCCATCATTTGAGAATGCCGGTGGTGAAGAAACCAGGCTTCTTCCA
 
. : . : . : . : . : . :
JMFS019D03+ CCTCTTATCATTTTTTTTTTTACTTTTTCCTCTCTGTTTTTATAATATTCCAGTTGTAGA
JMFF047H09+ CCTCTTATCA-TTTTTTTTTTACTTTTTCCTCTCTGTTTTTATAATATTCCAGTTGTAGA
JMFS055H04+ CCTCTTATCATTTTTTTTTTTACTTTTTCCTCTCTGTTTTTATAATATTCCAGTTGTAGA
JMFS126H11+ CCTCTTATCATTTTTTTTTTTACTTTTTCCTCTCTGTTTTTATAATATTCCAGTTGTAGA
JMSF022A07+ CCTCTTATCATTTTTTTTTTTACTTTTTCCTCTCTGTTTTTATAATATTCCAGTTGTAGA
                      ____________________________________________________________
consensus CCTCTTATCATTTTTTTTTTTACTTTTTCCTCTCTGTTTTTATAATATTCCAGTTGTAGA
 
. : . : . : . : . : . :
JMFS019D03+ CAGCTGAAATATGGTTATTCTGCACCTCGCCGCCTCGCAGTCGTCGCTGCTGGACTCGTT
JMFF047H09+ CAGCTGAAATATGGTTATTCTGCACCTCGCCGCCTCGCAGTCGTCGCTGCTGGACTCGTT
JMFS055H04+ CAGCTGAAATATGGTTATTCTGCACCTCGCCGCCTCGCAGTCGTCGCTGCTGGACTCGTT
JMFS126H11+ CAGCTGAAATATGGTTATTCTGCACCTCGCCGCCTCGCAGTCGTCGCTGCTGGACTCGTT
JMSF022A07+ CAGCTGAAATATGGTTATTCTGCACCTCGCCGCCTCGCAGTCGTCGCTGCTGGACTCGTT
                      ____________________________________________________________
consensus CAGCTGAAATATGGTTATTCTGCACCTCGCCGCCTCGCAGTCGTCGCTGCTGGACTCGTT
 
. : . : . : . : . : . :
JMFS019D03+ GTCCTTGTCTCGAGAGTCGACTCTCTCGACTCTCGTTGAATGACTTGAATCGTTGATATT
JMFF047H09+ GTCCTTGTCTCGAGAGTCGACTCTCTCGACTCTCGTTGAATGACTTGAATCGTTGATATT
JMFS055H04+ GTCCTTGTCTCGAGAGTCGACTCTCTCGACTCTCGTTGAATGACTTGAATCGTTGATATT
JMFS126H11+ GTCCTTGTCTCGAGAGTCGACTCTCTCGACTCTCGTTGAATGACTTGAATCGTTGATATT
JMSF022A07+ GTCCTTGTCTCGAGAGTCGACTCTCTCGACTCTCGTTGAATGACTTGAATCGTTGATATT
                      ____________________________________________________________
consensus GTCCTTGTCTCGAGAGTCGACTCTCTCGACTCTCGTTGAATGACTTGAATCGTTGATATT
 
. : . : . : . : . : . :
JMFS019D03+ AGGTTTTTCCCTTTTTGCTTATTATTCAGTTAATATATCAGAGCTTCTTCTCAACAAGCT
JMFF047H09+ AGGTTTTTCCCTTTTTGCTTATTATTCAGTTAATATATCAGAGCTTCTTCTCAACAAGCT
JMFS055H04+ AGGTTTTTCCCTTTTTGCTTATTATTCAGTTAATATATCAGAGCTTCTTCTCAACAAGCT
JMFS126H11+ AGGTTTTTCCCTTTTTGCTTATTATTCAGTTAATATATCAGAGCTTCTTCTCAACAAGCT
JMSF022A07+ AGGTTTTTCCCTTTTTGCTTATTATTCAGTTAATATATCAGAGCTTCTTCTCAACAAGCT
                      ____________________________________________________________
consensus AGGTTTTTCCCTTTTTGCTTATTATTCAGTTAATATATCAGAGCTTCTTCTCAACAAGCT
 
. : . : . : . : . : . :
JMFS019D03+ TG
JMFF047H09+ TGAGGTAAGCGGAAGGT
JMFS055H04+ TGAGGTAAGCGGAAGGTACTGAAACTCAG
JMFS126H11+ TGAGGTAAGCGGAAGGTACTGAAACTCAG
JMSF022A07+ TGAGGTAAGCGGAAGGTACTGAAACTCAGAGGAGAAGAAGACACCAAGTAACGTTTGTTC
                      ____________________________________________________________
consensus TGAGGTAAGCGGAAGGTACTGAAACTCAGAGGAGAAGAAGACACCAAGTAACGTTTGTTC