Previous Contig 006035:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001C07Sequence220006035 (4)gb:AP004744_18442302e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN771021962gb:AP004744_18442301e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF021P18Sequence651006035 (4)gb:AP004744_18442302e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN788013163 (3)gb:BT002405_16360082e-39Arabidopsis thaliana putative protein (At5g35400) mRNA, complete cds.>gb:BT00851
JMSF028E08Sequence619006035 (4)gb:AP004744_18442301e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN692013163 (3)gb:AP004744_18442309e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF038H09Sequence658006035 (4)gb:AP004744_18442305e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN894013163 (3)gb:BT002405_16360081e-40Arabidopsis thaliana putative protein (At5g35400) mRNA, complete cds.>gb:BT00851

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038H09+ TGCTATGCTATTTAT
                      ____________________________________________________________
consensus TGCTATGCTATTTAT
 
. : . : . : . : . : . :
JMSF038H09+ AGCATCTGCAATATCTTGAACCTTGACATCCTTTCTCCAAGTATAGAAAGAACAGACTTG
JMSF028E08+ CCTTGACATCCTTTCTCCAAGTATAGAAAGAACAGACTTG
JMSF021P18+ AATATCTTGAACCTTGACATCCTTTCTCCAAGTATAGAAAGAACAGACTTG
                      ____________________________________________________________
consensus AGCATCTGCAATATCTTGAACCTTGACATCCTTTCTCCAAGTATAGAAAGAACAGACTTG
 
. : . : . : . : . : . :
JMSF038H09+ TTGAGAAGCTGAAACACCCTTATCAGTGCGCCCAGCAACTACAGCACAACCTTCTAATGG
JMSF028E08+ TTGAGAAGCTGAAACACCCTTATCAGTGCGCCCAGCAACTACAGCACAACCTTCTAATGG
JMSF021P18+ TTGAGAAGCTGAAACACCCTTATCAGTGCGCCCAGCAACTACAGCACAACCTTCTAATGG
                      ____________________________________________________________
consensus TTGAGAAGCTGAAACACCCTTATCAGTGCGCCCAGCAACTACAGCACAACCTTCTAATGG
 
. : . : . : . : . : . :
JMSF038H09+ TAAGTTCTTATCCTTTAGTTGTTGAGCTTTTTTCTCATCAACAAATTGTCCAAGAGCTCT
JMSF028E08+ TAAGTTCTTATCCTTTAGTTGTTGAGCTTTTTTCTCATCAACAAATTGTCCAAGAGCTCT
JMSF021P18+ TAAGTTCTTATCCTTTAGTTGTTGAGCTTTTTTCTCATCAACAAATTGTCCAAGAGCTCT
                      ____________________________________________________________
consensus TAAGTTCTTATCCTTTAGTTGTTGAGCTTTTTTCTCATCAACAAATTGTCCAAGAGCTCT
 
. : . : . : . : . : . :
JMSF038H09+ TTCGACCAACTCCTGAACTGTAGTCAGACCAGGCTGCTTCTGCCAGCCACCAAAGGAGGC
JMSF028E08+ TTCGACCAACTCCTGAACTGTAGTCAGACCAGGCTGCTTCTGCCAGCCACCAAAGGAGGC
JMSF021P18+ TTCGACCAACTCCTGAACTGTAGTCAGACCAGGCTGCTTCTGCCAGCCACCAAAGGAGGC
                      ____________________________________________________________
consensus TTCGACCAACTCCTGAACTGTAGTCAGACCAGGCTGCTTCTGCCAGCCACCAAAGGAGGC
 
. : . : . : . : . : . :
JMSF038H09+ CCCATGATATGATAGGACTATCTTAAACGTCACTCTTGCCCATCTCCCTGTCCTATCTTC
JMSF028E08+ CCCATGATATGATAGGACTATCTTAAACGTCACTCTTGCCCATCTCCCTGTCCTATCTTC
JMSF021P18+ CCCATGATATGATAGGACTATCTTAAACGTCACTCTTGCCCATCTCCCTGTCCTATCTTC
                      ____________________________________________________________
consensus CCCATGATATGATAGGACTATCTTAAACGTCACTCTTGCCCATCTCCCTGTCCTATCTTC
 
. : . : . : . : . : . :
JMSF038H09+ AACTGGAAAACTACCTAACTCCGATTTCACAAAATCTTCTATAGCTTCGGCATCATCTTG
JMSF028E08+ AACTGGAAAACTACCTAACTCCGATTTCACAAAATCTTCTATAGCTTCGGCATCATCTTG
JMSF021P18+ AACTGGAAAACTACCTAACTCCGATTTCACAAAATCTTCTATAGCTTCGGCATCATCTTG
                      ____________________________________________________________
consensus AACTGGAAAACTACCTAACTCCGATTTCACAAAATCTTCTATAGCTTCGGCATCATCTTG
 
. : . : . : . : . : . :
JMSF038H09+ AATAGGATGCGACAGTGGTGGAACCTCTTTTTGAAACAATCCTGCCAAATTTGACTGGCC
JMSF028E08+ AATAGGATGCGACAGTGGTGGAACCTCTTTTTGAAACAATCCTGCCAAATTTGACTGGCC
JMSF021P18+ AATAGGATGCGACAGTGGTGGAACCTCTTTTTGAAACAATCCTGCCAAATTTGACTGGCC
                      ____________________________________________________________
consensus AATAGGATGCGACAGTGGTGGAACCTCTTTTTGAAACAATCCTGCCAAATTTGACTGGCC
 
. : . : . : . : . : . :
JMSF038H09+ TTTCACCATTTCTGTATAAAAATCAACAATTTTTTGCCATGGCCTAGCAGACATGAACTG
JMSF028E08+ TTTCACCATTTCTGTATAAAAATCAACAATTTTTTGCCATGGCCTAGCAGACATGAACTG
JMSF001C07+ TTCTGTATAAAAATCAACAATTTTTTGCCATGGCCTAGCAGACATGAACTG
JMSF021P18+ TTTCACCATTTCTGTATAAAAATCAACAATTTTTTGCCATGGCCTAGCAGACATGAACTG
                      ____________________________________________________________
consensus TTTCACCATTTCTGTATAAAAATCAACAATTTTTTGCCATGGCCTAGCAGACATGAACTG
 
. : . : . : . : . : . :
JMSF038H09+ GTAACATTCCTTGGAAGTCCATCTGGAGAATTTGCAGGAATCAGTGTGGTTGTAGTGATA
JMSF028E08+ GTAACATTCCTTGGAAGTCCATCTGGAGAATTTGCAGGAATCAGTGTGGTTGTAGTGATA
JMSF001C07+ GTAACATTCCTTGGAAGTCCATCTGGAGAATTTGCAGGAATCAGTGTGGTTGTAGTGATA
JMSF021P18+ GTAACATTCCTTGGAAGTCCATCTGGAGAATTTGCAGGAATCAGTGTGGTTGTAGTGATA
                      ____________________________________________________________
consensus GTAACATTCCTTGGAAGTCCATCTGGAGAATTTGCAGGAATCAGTGTGGTTGTAGTGATA
 
. : . : . : . : . : . :
JMSF038H09+ AACCTTCTTAGGAGCCGCTTGCTGACTTTCCATAATGTTTTTTATGGTCCGCACCACCGT
JMSF028E08+ AACCTTCTTAGGAGCCGCTTGCTGACTTTCCATAATGTTTTTTATGGTCCGCACCACCGT
JMSF001C07+ AACCTTCTTAGGAGCCGCTTGCTGACTTTCCATAATGTTTTTTATGGTCCGCACCACCGT
JMSF021P18+ AACCTTCTTAGGAGCCGCTTGCTGACTTTCCATAATGTTTTTTATGGTCCGCACCACCGT
                      ____________________________________________________________
consensus AACCTTCTTAGGAGCCGCTTGCTGACTTTCCATAATGTTTTTTATGGTCCGCACCACCGT
 
. : . : . : . : . : . :
JMSF038H09+ CGGAGAGTTTATCATGACCACTGCCGCCGTTCGTCTC
JMSF028E08+ CGGAGAGTTTATCATGACCACTGCCGCCGTTCGTCTC
JMSF001C07+ CGGAGAGTTTATCATGACCACTGCCGCCGTTCGTCTCTGCCC
JMSF021P18+ CGGAGAGTTTATCATGACCACTGCCGCCGTTCGTCTCTGCCCGAAATGGTATTGTCAGCC
                      ____________________________________________________________
consensus CGGAGAGTTTATCATGACCACTGCCGCCGTTCGTCTCTGCCCGAAATGGTATTGTCAGCC