Previous Contig 006028:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049F14Sequence636006028 (9)gb:AY065371_15664834e-73Arabidopsis thaliana unknown protein (At3g44150) mRNA, complete cds.>gb:AY150454559006028 (9)gb:AY065371_15664838e-60Arabidopsis thaliana unknown protein (At3g44150) mRNA, complete cds.>gb:AY150454
JMFN004N04Sequence639006028 (9)gb:AY065371_15664832e-71Arabidopsis thaliana unknown protein (At3g44150) mRNA, complete cds.>gb:AY150454
JMFN036M08Sequence622006028 (9)gb:AY065371_15664832e-65Arabidopsis thaliana unknown protein (At3g44150) mRNA, complete cds.>gb:AY150454
JMSF021O02Sequence665006028 (9)gb:AY065371_15664836e-76Arabidopsis thaliana unknown protein (At3g44150) mRNA, complete cds.>gb:AY150454670006028 (9)gb:AY065371_15664833e-77Arabidopsis thaliana unknown protein (At3g44150) mRNA, complete cds.>gb:AY150454
JMSF021P02Sequence670006028 (9)gb:AY065371_15664834e-78Arabidopsis thaliana unknown protein (At3g44150) mRNA, complete cds.>gb:AY150454720006028 (9)gb:AY065371_15664834e-78Arabidopsis thaliana unknown protein (At3g44150) mRNA, complete cds.>gb:AY150454
JMSF022P02Sequence675006028 (9)gb:AY065371_15664831e-78Arabidopsis thaliana unknown protein (At3g44150) mRNA, complete cds.>gb:AY150454

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF049F14- AAT
JMFN036M08+ GAGAGAGAAAAAAACATCTTTCCACAAT
                      ____________________________________________________________
consensus GAGAGAGAAAAAAACATCTTTCCACAAT
 
. : . : . : . : . : . :
rJMFF049F14- CCACACAGAGGTTTAATAGTTTGAAGAAAGTAAGAGATTTACATATTTTTGCATACAAAC
JMFN036M08+ CCACACAGAGGTTTAATAGTTTGAAGAAAGTAAGAGATTTACATATTTTTGCATACAAAC
rJMSF021O02- ATAGTTTGAAGAAAGTAAGAGATTTACATATTTTTGCATACAAAC
rJMSF021P02- ATAGTTTGAAGAAAGTAAGAGATTTACATATTTTTGCATACAAAC
                      ____________________________________________________________
consensus CCACACAGAGGTTTAATAGTTTGAAGAAAGTAAGAGATTTACATATTTTTGCATACAAAC
 
. : . : . : . : . : . :
rJMFF049F14- GAAGGACCAGAGTGTATAGAAATAATGAAGGATGTTTAAGAATTTGTTCACCGATTCTAT
JMFN036M08+ GAAGGACCAGAGTGTATAGAAATAATGAAGGATGTTTAAGAATTTGTTCACCGATTCTAT
rJMSF021O02- GAAGGACCAGAGTGTATAGAAATAATGAAGGATGTTTAAGAATTTGTTCACCGATTCTAT
rJMSF021P02- GAAGGACCAGAGTGTATAGAAATAATGAAGGATGTTTAAGAATTTGTTCACCGATTCTAT
                      ____________________________________________________________
consensus GAAGGACCAGAGTGTATAGAAATAATGAAGGATGTTTAAGAATTTGTTCACCGATTCTAT
 
. : . : . : . : . : . :
rJMFF049F14- CCACATGTGGGAATAAAACACAGATTAGAAGAATTTGTTGTACTGACTGGTGAGGGAATC
JMFN036M08+ CCACATGTGGGAATAAAACACAGATTAGAAGAATTTGTTGTACTGACTGGTGAGGGAATC
rJMSF021O02- CCACATGTGGGAATAAAACACAGATTAGAAGAATTTGTTGTACTGACTGGTGAGGGAATC
rJMSF021P02- CCACATGTGGGAATAAAACACAGATTAGAAGAATTTGTTGTACTGACTGGTGAGGGAATC
                      ____________________________________________________________
consensus CCACATGTGGGAATAAAACACAGATTAGAAGAATTTGTTGTACTGACTGGTGAGGGAATC
 
. : . : . : . : . : . :
rJMFF049F14- CTTGAGATTAGAATAGACGCTATAAAGGGAGTACTGCCGGAGGTTCTTCACTTCATACCA
JMFN036M08+ CTTGAGATTAGAATAGACGCTATAAAGGGAGTACTGCCGGAGGTTCTTCACTTCATACCA
rJMSF021O02- CTTGAGATTAGAATAGACGCTATAAAGGGAGTACTGCCGGAGGTTCTTCACTTCATACCA
rJMSF021P02- CTTGAGATTAGAATAGACGCTATAAAGGGAGTACTGCCGGAGGTTCTTCACTTCATACCA
JMSF022P02+ CTTCACTTCATACCA
JMSF021P02+ CTTCATACCA
JMSF021O02+ TACCA
                      ____________________________________________________________
consensus CTTGAGATTAGAATAGACGCTATAAAGGGAGTACTGCCGGAGGTTCTTCACTTCATACCA
 
. : . : . : . : . : . :
rJMFF049F14- CGAGTTGAAAACCGACTCGTGCTTATCAGTGCCGGAGAATGTCAGTTGTATTCCAAGGCT
JMFN036M08+ CGAGTTGAAAACCGACTCGTGCTTATCAGTGCCGGAGAATGTCAGTTGTATTCCAAGGCT
rJMSF021O02- CGAGTTGAAAACCGACTCGTGCTTATCAGTGCCGGAGAATGTCAGTTGTATTCCAAGGCT
rJMSF021P02- CGAGTTGAAAACCGACTCGTGCTTATCAGTGCCGGAGAATGTCAGTTGTATTCCAAGGCT
JMSF022P02+ CGAGTTGAAAACCGACTCGTGCTTATCAGTGCCGGAGAATGTCAGTTGTATTCCAAGGCT
JMSF021P02+ CGAGTTGAAAACCGACTCGTGCTTATCAGTGCCGGAGAATGTCAGTTGTATTCCAAGGCT
JMFF049F14+ GCTTATCAGTGCCGGAGAATGTCAGTTGTATTCCAAGGCT
JMFN004N04+ GCTTATCAGTGCCGGAGAATGTCAGTTGTATTCCAAGGCT
JMSF021O02+ CGAGNTGAAAACCGACTCGTGCTTATCAGTGCCGGAGAATGTCAGTTGTATTCCAAGGCT
                      ____________________________________________________________
consensus CGAGTTGAAAACCGACTCGTGCTTATCAGTGCCGGAGAATGTCAGTTGTATTCCAAGGCT
 
. : . : . : . : . : . :
rJMFF049F14- ACAGTCTACATTCCCACCTCGGTTCTTGCAGGAATTGGTCTTCATAGCACAATCTTGACC
JMFN036M08+ ACAGTCTACATTCCCACCTCGGTTCTTGCAGGAATTGGTCTTCATAGCACAATCTTGACC
rJMSF021O02- ACAGTCTACATTCCCACCTCGGTTCTTGCAGGAATTGGTCTTCATAGCACAATCTTGACC
rJMSF021P02- ACAGTCTACATTCCCACCTCGGTTCTTGCAGGAATTGGTCTTCATAGCACAATCTTGACC
JMSF022P02+ ACAGTCTACATTCCCACCTCGGTTCTTGCAGGAATTGGTCTTCATAGCACAATCTTGACC
JMSF021P02+ ACAGTCTACATTCCCACCTCGGTTCTTGCAGGAATTGGTCTTCATAGCACAATCTTGACC
JMFF049F14+ ACAGTCTACATTCCCACCTCGGTTCTTGCAGGAATTGGTCTTCATAGCACAATCTTGACC
JMFN004N04+ ACAGTCTACATTCCCACCTCGGTTCTGNCAGGAATTGGTCTTCATAGCACAATCTTGACC
JMSF021O02+ ACAGTCTACATTCCCACCTCGGTTCTTGCAGGAATTGGTCTTCATAGCACAATCTTGACC
                      ____________________________________________________________
consensus ACAGTCTACATTCCCACCTCGGTTCTTGCAGGAATTGGTCTTCATAGCACAATCTTGACC
 
. : . : . : . : . : . :
rJMFF049F14- ATTGAGGCATGTGAAGCCTGAGCTGCCTTTGCACGATGCACACCCATCCCTCTTCCAGTA
JMFN036M08+ ATTGAGGCATGTGAAGCCTGAGCTGCCTTTGCACGATGCACACCCATCCCTCTTCCAGTA
rJMSF021O02- ATTGAGGCATGTGAAGCCTGAGCTGCCTTTGCACGATGCACACCCATCCCTCTTCCAGTA
rJMSF021P02- ATTGAGGCATGTGAAGCCTGAGCTGCCTTTGCACGATGCACACCCATCCCTCTTCCAGTA
JMSF022P02+ ATTGAGGCATGTGAAGCCTGAGCTGCCTTTGCACGATGCACACCCATCCCTCTTCCAGTA
JMSF021P02+ ATTGAGGCATGTGAAGCCTGAGCTGCCTTTGCACGATGCACACCCATCCCTCTTCCAGTA
JMFF049F14+ ATTGAGGCATGTGAAGCCTGAGCTGCCTTTGCACGATGCACACCCATCCCTCTTCCAGTA
JMFN004N04+ ATTGAGGCATGTGAAGCCTGAGCTGCCTTTGCACGATGCACACCCATCCCTCTTCCAGTA
JMSF021O02+ ATTGAGGCATGTGAAGCCTGAGCTGCCTTTGCACGATGCACACCCATCCCTCTTCCAGTA
                      ____________________________________________________________
consensus ATTGAGGCATGTGAAGCCTGAGCTGCCTTTGCACGATGCACACCCATCCCTCTTCCAGTA
 
. : . : . : . : . : . :
rJMFF049F14- CAGGTTTTGCAGTCTGCCCTTTTTGAATTCAAAAACCAGGGTAAAGCTTGACACGATGTA
JMFN036M08+ CAGGTTTTGCAGTCTGCCCTTTTTGAATTCAAAAACCAGGGTAAAGCTTGACACGATGTA
rJMSF021O02- CAGGTTTTGCAGTCTGCCCTTTTTGAATTCAAAAACCAGGGTAAAGCTTGACACGATGTA
rJMSF021P02- CAGGTTTTGCAGTCTGCCCTTTTTGAATTCAAAAACCAGGGTAAAGCTTGACACGATGTA
JMSF022P02+ CAGGTTTTGCAGTCTGCCCTTTTTGAATTCAAAAACCAGGGTAAAGCTTGACACGATGTA
JMSF021P02+ CAGGTTTTGCAGTCTGCCCTTTTTGAATTCAAAAACCAGGGTAAAGCTTGACACGATGTA
JMFF049F14+ CAGGTTTTGCAGTCTGCCCTTTTTGAATTCAAAAACCAGGGTAAAGCTTGACACGATGTA
JMFN004N04+ CAGGTTTTGCAGTCTGCCCTTTTTGAATTCAAAAACCAGGGTAAAGCTTGACACGATGTA
JMSF021O02+ CAGGTTTTGCAGTCTGCCCTTTTTGAATTCAAAAACCAGGGTAAAGCTTGACACGATGTA
                      ____________________________________________________________
consensus CAGGTTTTGCAGTCTGCCCTTTTTGAATTCAAAAACCAGGGTAAAGCTTGACACGATGTA
 
. : . : . : . : . : . :
rJMFF049F14- ACTCCCGTTAGCAACAAAAGCTGGGGGAGACCTAGCAGCATATTTCCTACCAGCAAATGC
JMFN036M08+ ACTCCCGTTAGCAACAAAAGCTGGGGGAGACCTAGCAGCATATTTCCTACCAGCAAATGC
rJMSF021O02- ACTCCCGTTAGCAACAAAAGCTGGGGGAGACCTAGCAGCATATTTCCTACCAGCAAATGC
rJMSF021P02- ACTCCCGTTAGCAACAAAAGCTGGGGGAGACCTAGCAGCATATTTCCTACCAGCAAATGC
JMSF022P02+ ACTCCCGTTAGCAACAAAAGCTGGGGGAGACCTAGCAGCATATTTCCTACCAGCAAATGC
JMSF021P02+ ACTCCCGTTAGCAACAAAAGCTGGGGGAGACCTAGCAGCATATTTCCTACCAGCAAATGC
JMFF049F14+ ACTCCCGTTAGCAACAAAAGCTGGGGGAGACCTAGCAGCATATTTCCTACCAGCAAATGC
JMFN004N04+ ACTCCCGTTAGCAACAAAAGCTGGGGGAGACCTAGCAGCATATTTCCTACCAGCAAATGC
JMSF021O02+ ACTCCCGTTAGCAACAAAAGCTGGGGGAGACCTAGCAGCATATTTCCTACCAGCAAATGC
                      ____________________________________________________________
consensus ACTCCCGTTAGCAACAAAAGCTGGGGGAGACCTAGCAGCATATTTCCTACCAGCAAATGC
 
. : . : . : . : . : . :
rJMFF049F14- CACCATATACCCTCCA
JMFN036M08+ CACCATATACCCTCCAACAGAGTCCGGGAAGAAGCTGGAGGTGTTGACGGTGAG
rJMSF021O02- CACCATATACCCTCCAACAGAGTCCGGGAAGAAGCTGGAGGTGTTGACGGTGAGAAGCGA
rJMSF021P02- CACCATATACCCTCCAACAGAGTCCGGGAAGAAGCTGGAGGTGTTGACGGTGAGAAGCGA
JMSF022P02+ CACCATATACCCTCCAACAGAGTCCGGGAAGAAGCTGGAGGTGTTGACGGTGAGAAGCGA
JMSF021P02+ CACCATATACCCTCCAACAGAGTCCGGGAAGAAGCTGGAGGTGTTGACGGTGAGAAGCGA
JMFF049F14+ CACCATATACCCTCCAACAGAGTCCGGGAAGAAGCTGGAGGTGTTGACGGTGAGAAGCGA
JMFN004N04+ CACCATATACCCTCCAACAGAGTCCGGGAAGAAGCTGGAGGTGTTGACGGTGAGAAGCGA
JMSF021O02+ CACCATATACCCTCCAACAGAGTCCGGGAAGAAGCTGGAGGTGTTGACGGTGAGAAGCGA
                      ____________________________________________________________
consensus CACCATATACCCTCCAACAGAGTCCGGGAAGAAGCTGGAGGTGTTGACGGTGAGAAGCGA
 
. : . : . : . : . : . :
rJMSF021O02- GATCTCGTCGACTTTAGGTCGGAAGACAGCGAGCTGAGCGTTGTTGAGGGAGAGGCGGCG
rJMSF021P02- GATCTCGTCGACTTTAGGTCGGAAGACAGCGAGCTGAGCGTTGTTGAGGGAGAGGCGGCG
JMSF022P02+ GATCTCGTCGACTTTAGGTCGGAAGACAGCGAGCTGAGCGTTGTTGAGGGAGAGGCGGCG
JMSF021P02+ GATCTCGTCGACTTTAGGTCGGAAGACAGCGAGCTGAGCGTTGTTGAGGGAGAGGCGGCG
JMFF049F14+ GATCTCGTCGACTTTAGGTCGGAAGACAGCGAGCTGAGCGTTGTTGAGGGAGAGGCGGCG
JMFN004N04+ GATCTCGTCGACTTTAGGTCGGAAGACAGCGAGCTGAGCGTTGTTGAGGGAGAGGCGGCG
JMSF021O02+ GATCTCGTCGACTTTAGGTCGGAAGACAGCGAGCTGAGCGTTGTTGAGGGAGAGGCGGCG
                      ____________________________________________________________
consensus GATCTCGTCGACTTTAGGTCGGAAGACAGCGAGCTGAGCGTTGTTGAGGGAGAGGCGGCG
 
. : . : . : . : . : . :
rJMSF021O02- GTCGCAGGGAGACAGCTGG
rJMSF021P02- GTCGCAGGGAGACAGCTGGACATCTTTGTTTTTGCTGTCGTTGATGAAGGTAGCGTTCCT
JMSF022P02+ GTCGCAGGGAGACAGCTGGACATCTTTGTTTTTGCTGTCGTTGATGAAGGTAGCGTTCCT
JMSF021P02+ GTCGCAGGGAGACAGCTGGACATCTTTGTTTTTGCTGTCGTTGATGAAGGTAGCGTTCCT
JMFF049F14+ GTCGCAGGGAGACAGCTGGACATCTTTGTTTTTGCTGTCGTTGATGAAGGTAGCGTTCCT
JMFN004N04+ GTCGCAGGGAGACAGCTGGACATCTTTGTTTTTGCTGTCGTTGATGAAGGTAGCGTTCCT
JMSF021O02+ GTCGCAGGGAGACAGCTGGACATCTTTGTTTTTGCTGTCGTTGATGAAGGTAGCGTTCCT
                      ____________________________________________________________
consensus GTCGCAGGGAGACAGCTGGACATCTTTGTTTTTGCTGTCGTTGATGAAGGTAGCGTTCCT
 
. : . : . : . : . : . :
rJMSF021P02- CGCCGCGA
JMSF022P02+ CGCCGCGAATACGATTCCGAAGGTGAAGCCGTCGGACTTCTGTACCGTCGTATCGGCGCA
JMSF021P02+ CGCCGCGAATACGATTCCGAAGGTGAAGCCGTCGGACTTCTGTACCGTCGTATCGGCGCA
JMFF049F14+ CGCCGCGAATACGATTCCGAAGGTGAAGCCGTCGGACTTCTGTACCGTCGTATCGGCGCA
JMFN004N04+ CGCCGCGAATACGATTCCGAAGGTGAAGCCGTCGGACTTCTGTACCGTCGTATCGGCGCA
JMSF021O02+ CGCCGCGAATACGATTCCGAAGGTGAAGCCGTCGGACTTCTGTACCGTCGTATCGGCGCA
                      ____________________________________________________________
consensus CGCCGCGAATACGATTCCGAAGGTGAAGCCGTCGGACTTCTGTACCGTCGTATCGGCGCA
 
. : . : . : . : . : . :
JMSF022P02+ CGGCGAGAACACGTGGTTCGTGTCGCTGCTCGATTCAGCCAAGAGAAAGAGAGTTGGGAA
JMSF021P02+ CGGCGAGAACACGTGGTTCGTGTCGCTGCTCGATTCAGCCAAGAGAAAGAGAGTTGGGAA
JMFF049F14+ CGGCGAGAACACGTGGTTCGTGTCGCTGCTCGATTCAGCCAAGAGAAAGAGAGTTGGGAA
JMFN004N04+ CGGCGAGAACACGTGGTTCGTGTCGCTGCTCGATTCAGCCAAGAGAAAGAGAGTTGGGAA
JMSF021O02+ CGGCGAGAACACGTGGTTCGTGTCGCTGCTCGATTCAGCCAAGAGAAAGAGAGTTGGGAA
                      ____________________________________________________________
consensus CGGCGAGAACACGTGGTTCGTGTCGCTGCTCGATTCAGCCAAGAGAAAGAGAGTTGGGAA
 
. : . : . : . : . : . :
JMSF022P02+ GATCAGCAGAGAGAGAATCGCCGACGGCCTCGCCATAGTTGGTTTGATCGCCGTTCAGC
JMSF021P02+ GATCAGCAGAGAGAGAATCGCCGACGGCCTCGCCATAGTTGGTTTGATCGCCGTTCAGC
JMFF049F14+ GATCAGCAGAGAGAGAATCGCCGACGGCCTCGCCATAGTTGGTTTGATCGCCGTTC
JMFN004N04+ GATCAGCAGAGAGAGAATCGCCGACGGCCTCGCCATAGTTGGTTTGATCGCCGTTCAGC
JMSF021O02+ GATCAGCAGAGAGAGAATCGCCGACGGCCTCGCCATAGTTGGTTTGATCGCCGTTCAGCC
                      ____________________________________________________________
consensus GATCAGCAGAGAGAGAATCGCCGACGGCCTCGCCATAGTTGGTTTGATCGCCGTTCAGCC