Previous Contig 006023:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042P02Sequence614006023 (3)gb:AF216836_17781041e-71Solanum bulbocastanum forever young oxidoreductase (FEY) gene, complete cds.602010268 (2)gb:AF216836_17781042e-46Solanum bulbocastanum forever young oxidoreductase (FEY) gene, complete cds.
JMFS128D08Sequence612006023 (3)gb:AF216836_17781043e-79Solanum bulbocastanum forever young oxidoreductase (FEY) gene, complete cds.
JMSF021N15Sequence654006023 (3)gb:AF216836_17781045e-75Solanum bulbocastanum forever young oxidoreductase (FEY) gene, complete cds.763010268 (2)gb:AF216836_17781042e-76Solanum bulbocastanum forever young oxidoreductase (FEY) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS128D08+ GCAATATGGAAAGCAATGCTGGAGCAAGATGATTCACTT
JMFF042P02+ CTGGAGCAAGATGATTCACTT
JMSF021N15+ TAAGGGATGGTAAAAGCAATATGGAAAGCAATGCTGGAGCAAGATGATTCACTT
                      ____________________________________________________________
consensus TAAGGGATGGTAAAAGCAATATGGAAAGCAATGCTGGAGCAAGATGATTCACTT
 
. : . : . : . : . : . :
JMFS128D08+ GCATGTGTTCCTCATAACCATCCTTTGTGAATTTCTGTGGTTCACCAATAGAAAATATCC
JMFF042P02+ GCATGTGTTCCTCATAACCATCC-TTGTGAATTTCTGTGGTTCACCAATAGAAAATATCC
JMSF021N15+ GCATGTGTTCCTCATAACCATCCTTTGTGAATTTCTGTGGTTCACCAATAGAAAATATCC
                      ____________________________________________________________
consensus GCATGTGTTCCTCATAACCATCCTTTGTGAATTTCTGTGGTTCACCAATAGAAAATATCC
 
. : . : . : . : . : . :
JMFS128D08+ CAGCATTGTTAATGAGGACATGTAATGGTCCTGCACGTGCATTCCATGCATCTGCAAATC
JMFF042P02+ CAGCATTGTTAATGAGGACATGTAATGGTCCTGCACGTGCATTCCATGCATCTGCAAATC
JMSF021N15+ CAGCATTGTTAATGAGGACATGTAATGGTCCTGCACGTGCATTCCATGCATCTGCAAATC
                      ____________________________________________________________
consensus CAGCATTGTTAATGAGGACATGTAATGGTCCTGCACGTGCATTCCATGCATCTGCAAATC
 
. : . : . : . : . : . :
JMFS128D08+ TCACAACAGAATCCAAGGAGACAAGATCAAGTTCCATGACCTCAATATTGAGAGGAAGGC
JMFF042P02+ TCACAACAGAATCCAAGGAGACAAGATCAAGTTCCATGACCTCAATATTGAGAGGAAGGC
JMSF021N15+ TCACAACAGAATCCAAGGAGACAAGATCAAGTTCCATGACCTCAATATTGAGAGGAAGGC
                      ____________________________________________________________
consensus TCACAACAGAATCCAAGGAGACAAGATCAAGTTCCATGACCTCAATATTGAGAGGAAGGC
 
. : . : . : . : . : . :
JMFS128D08+ CCTTCCCTGCCCAATCCTCCTGCCACTTCTTTATCAATTCATTTGCAGCCTTTGTATTTC
JMFF042P02+ CCTTCCCTGCCCAATCCTCCTGCCACTTCTTTATCAATTCATTTGCAGCCTTTGTATTTC
JMSF021N15+ CCTTCCCTGCCCAATCCTCCTGCCACTTCTTTATCAATTCATTTGCAGCCTTTGTATTTC
                      ____________________________________________________________
consensus CCTTCCCTGCCCAATCCTCCTGCCACTTCTTTATCAATTCATTTGCAGCCTTTGTATTTC
 
. : . : . : . : . : . :
JMFS128D08+ TGACTGCCATAACCACATGAGCCCCTGCTTCTGCCAATTGTCTAGCGATTTCCCGGCCGA
JMFF042P02+ TGACTGCCATAACCACATGAGCCCCTGCTTCTGCCAATTGTCTAGCGATTTCCCGGCCGA
JMSF021N15+ TGACTGCCATAACCACATGAGCCCCTGCTTCTGCCAATTGTCTAGCGATTTCCCGGCCGA
                      ____________________________________________________________
consensus TGACTGCCATAACCACATGAGCCCCTGCTTCTGCCAATTGTCTAGCGATTTCCCGGCCGA
 
. : . : . : . : . : . :
JMFS128D08+ TACCGCTGGTGGAGCCGGTGACGATACAGGTGAGATCATTGACTGGAGGGAGAGGCATAG
JMFF042P02+ TACCGCTGGTGGAGCCGGTGACGATACAGGTGAGATCATTGACTGGAGGGAGAGGCATAG
JMSF021N15+ TACCGCTGGTGGAGCCGGTGACGATACAGGTGAGATCATTGACTGGAGGGAGAGGCATAG
                      ____________________________________________________________
consensus TACCGCTGGTGGAGCCGGTGACGATACAGGTGAGATCATTGACTGGAGGGAGAGGCATAG
 
. : . : . : . : . : . :
JMFS128D08+ GGTTCTCCAAGTGGCTTGCGGCTATCCTCTGGAACAGCAGCTCATAGACCACGAACAACA
JMFF042P02+ GGTTCTCCAAGTGGCTTGCGGCTATCCTCTGGAACAGCAGCTCATAGACCACGAACAACA
JMSF021N15+ GGTTCTCCAAGTGGCTTGCGGCTATCCTCTGGAACAGCAGCTCATAGACCACGAACAACA
                      ____________________________________________________________
consensus GGTTCTCCAAGTGGCTTGCGGCTATCCTCTGGAACAGCAGCTCATAGACCACGAACAACA
 
. : . : . : . : . : . :
JMFS128D08+ ACCCCCTCAGCCACTCTATCCATCCCAGCGCCACCTTCTTCTTCGGCCGCACATCTTCGC
JMFF042P02+ ACCCCCTCAGCCACTCTATCCATCCCAGCGCCACCTTCTTCTTCGGCCGCACATCTTCGC
JMSF021N15+ ACCCCCTCAGCCACTCTATCCATCCCAGCGCCACCTTCTTNTTCGGCCGCACATNTTCGC
                      ____________________________________________________________
consensus ACCCCCTCAGCCACTCTATCCATCCCAGCGCCACCTTCTTCTTCGGCCGCACATCTTCGC
 
. : . : . : . : . : . :
JMFS128D08+ TTCCACTACCCTCCTTTTTCTCCTTCGTCTCCGGCGCCATTCTCTTCTATCTCACTCTCT
JMFF042P02+ TTCCACTACCCTCCTTTTTCTCCTTCGTCTCCGGCGCCATTCTCTTCTATCTCACTCTCT
JMSF021N15+ TTCCACTACCCTCCTTTTTCTCCTTCGTCTCCGGCGCCATTCTCTTCTATCTCACTCTCT
                      ____________________________________________________________
consensus TTCCACTACCCTCCTTTTTCTCCTTCGTCTCCGGCGCCATTCTCTTCTATCTCACTCTCT
 
. : . : . : . : . : . :
JMFS128D08+ CTCTCACTCTCTCACTCTCTCACTATCTCTCTC
JMFF042P02+ CTCTCACTCTCTCACTCTCTCACTATCTCTCTCTCTCTCTCTCTTCCCCCGGGA
JMSF021N15+ CTCTCACTCTCTCACTCTCTCACTATCTCTCTCTCTCTCTCTCTTCCCCCGGGAGTTCTC
                      ____________________________________________________________
consensus CTCTCACTCTCTCACTCTCTCACTATCTCTCTCTCTCTCTCTCTTCCCCCGGGAGTTCTC