Previous Contig 006022:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050C06Sequence506006022 (6)pir|H84611|H846112e-66hypothetical protein At2g22370 [imported] - Arabidopsis thaliana>gb:AC006592_153390006022 (6)pir|H84611|H846119e-18hypothetical protein At2g22370 [imported] - Arabidopsis thaliana>gb:AC006592_153
JMFF051I15Sequence561006022 (6)pir|H84611|H846112e-68hypothetical protein At2g22370 [imported] - Arabidopsis thaliana>gb:AC006592_153545002307 (8)gb:ATAC012328_15434322e-33Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen
JMFN036C08Sequence630006022 (6)pir|H84611|H846118e-89hypothetical protein At2g22370 [imported] - Arabidopsis thaliana>gb:AC006592_153
JMSF021N05Sequence670006022 (6)pir|H84611|H846115e-89hypothetical protein At2g22370 [imported] - Arabidopsis thaliana>gb:AC006592_153709006022 (6)pir|H84611|H846111e-63hypothetical protein At2g22370 [imported] - Arabidopsis thaliana>gb:AC006592_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF050C06- ACAAAT
rJMSF021N05- CGATTGACTTGGTTCATACTAATATCTACAAAT
                      ____________________________________________________________
consensus CGATTGACTTGGTTCATACTAATATCTACAAAT
 
. : . : . : . : . : . :
rJMFF050C06- TTATGTAAAACATACATGTAATACTTTTGAACAAAATATAGTATTTTACATATAAGATCG
rJMSF021N05- TTATGTAAAACATACATGTAATACTTTTGAACAAAATATAGTATTTTACATATAAGATCG
                      ____________________________________________________________
consensus TTATGTAAAACATACATGTAATACTTTTGAACAAAATATAGTATTTTACATATAAGATCG
 
. : . : . : . : . : . :
rJMFF050C06- ATAGAAAATAGTACACGTCCCATAAAATGGTATTTGTGCTCTCTCACAAAACTATCTGAT
rJMSF021N05- ATAGAAAATAGTACACGTCCCATAAAATGGTATTTGTGCTCTCTCACAAAACTATCTGAT
                      ____________________________________________________________
consensus ATAGAAAATAGTACACGTCCCATAAAATGGTATTTGTGCTCTCTCACAAAACTATCTGAT
 
. : . : . : . : . : . :
rJMFF050C06- CTGTTCATTCAAATAGGCATTTGCTGTTGGGAATTTTGTGGCAATGAAATTAAAGCTTCT
rJMSF021N05- CTGTTCATTCAAATAGGCATTTGCTGTTGGGAATTTTGTGGCAATGAAATTAAAGCTTCT
                      ____________________________________________________________
consensus CTGTTCATTCAAATAGGCATTTGCTGTTGGGAATTTTGTGGCAATGAAATTAAAGCTTCT
 
. : . : . : . : . : . :
rJMFF050C06- TTTGATTGTATATCTGCGGGCACTACAGTTTTGTGCCTCCGCCATCTGATATCAAAAATG
rJMSF021N05- TTTGATTGTATATCTGCGGGCACTACAGTTTTGTGCCTCCGCCATCTGATATCAGAGATG
JMSF021N05+ ATG
                      ____________________________________________________________
consensus TTTGATTGTATATCTGCGGGCACTACAGTTTTGTGCCTCCGCCATCTGATATCAGAGATG
 
. : . : . : . : . : . :
rJMFF050C06- CAGCAGCTGCGGCGGCGGTAGGAACCACCCCTGTTGAGTTGCCTGGTTTTGACAAATGGA
rJMSF021N05- CAGCAGCTGCGGCGGCGGTAGGAACCACCCCTGTTGAGTTGCCTGGTTTTGACAAATGGA
JMFN036C08+ GCGGCGGCGGTAGGAACCACCCCTGTTGAGTTGCCTGGTTTTGACAAATGGA
JMSF021N05+ CAGCAGCTGCGGCGGCGGTAGGAACCACCCCTGTTGAGTTGCCTGGTTTTGACAAATGGA
                      ____________________________________________________________
consensus CAGCAGCTGCGGCGGCGGTAGGAACCACCCCTGTTGAGTTGCCTGGTTTTGACAAATGGA
 
. : . : . : . : . : . :
rJMFF050C06- GGAGCGGTGCAAGATATTCACAAAATGATGATACAGCAGCAGCAACTTCTGAGTAGTTTT
rJMSF021N05- GGAGCGGTGCAAGATATTCACAAAATGATGATACAGCAGCAGCAACTTCTGAGTAGTTTT
JMFN036C08+ GGAGCGGTGCAAGATATTCACAAAATGATGATACAGCAGCAGCAACTTCTGAGTAGTTTT
JMFF051I15+ TGATACAGCAGCAGCAACTTCTGAGTAGTTTT
JMSF021N05+ GGAGCGGTGCAAGATATTCACAAAATGATGATACAGCAGCAGCAACTTCTGAGTAGTTTT
                      ____________________________________________________________
consensus GGAGCGGTGCAAGATATTCACAAAATGATGATACAGCAGCAGCAACTTCTGAGTAGTTTT
 
. : . : . : . : . : . :
rJMFF050C06- CGGATGATGAGGGTGCTGTCACTT
rJMSF021N05- CGGATGATGAGGGTGCTGTCACTTCGACTAGCTGTATGCCCGGTGTTACAGGTACAGCCT
JMFN036C08+ CGGATGATGAGGGTGCTGTCACTTCGACTAGCTGTATGCCCGGTGTTACAGGTACAGCCT
JMFF051I15+ CGGATGATGAGGGTGCTGTCACTTCGACTAGCTGTATGCCCGGTGTTACAGGTACAGCCT
JMFF050C06+ AGCTGTATGCCCGGTGTTACAGGTACAGCTT
JMSF021N05+ CGGATGATGAGGGTGCTGTCACTTCGACTAGCTGTATGCCCGGTGTTACAGGTACAGCCT
                      ____________________________________________________________
consensus CGGATGATGAGGGTGCTGTCACTTCGACTAGCTGTATGCCCGGTGTTACAGGTACAGCCT
 
. : . : . : . : . : . :
rJMSF021N05- CGTCTGTGGCATGCAGCTTCAGCATCTTATTTATAGATGACACCGTGACAGTTATCTGGG
JMFN036C08+ CGTCTGTGGCATGCAGCTTCAGCATCTTATTTATAGATGACACCGTGACAGTTATCTGGG
JMFF051I15+ CGTCTGTGGCATGCAGCTTCAGCATCTTATTTATAGATGACACCGTGACAGTTATCTGGG
JMFF050C06+ CGTCTGTGGCATGCAGCTTCAGCATCTTATTTATAGATGACACCGTGACAGTTATCTGGG
JMSF021N05+ CGTCTGTGGCATGCAGCTTCAGCATCTTATTTATAGATGACACCGTGACAGTTATCTGGG
                      ____________________________________________________________
consensus CGTCTGTGGCATGCAGCTTCAGCATCTTATTTATAGATGACACCGTGACAGTTATCTGGG
 
. : . : . : . : . : . :
rJMSF021N05- CACCTCTTTGGAAATGGAAGGCAAAACCAACTCTCAAGAGCTCGTGGTCTAGTTTATAGC
JMFN036C08+ CACCTCTTTGGAAATGGAAGGCAAAACCAACTCTCAAGAGCTTGTGGTCTAGTTTATAGC
JMFF051I15+ CACCTCTTTGGAAATGGAAGGCAAAACCAACTCTCAAGAGCTCGTGGTCTAGTTTATAGC
JMFF050C06+ CACCTCTTTGGAAATGGAAGGCAAAACCAACTCTCAAGAGCTCGTGGTCTAGTTTATAGC
JMSF021N05+ CACCTCTTTGGAAATGGAAGGCAAAACCAACTCTCAAGAGCTCGTGGTCTAGTTTATAGC
                      ____________________________________________________________
consensus CACCTCTTTGGAAATGGAAGGCAAAACCAACTCTCAAGAGCTCGTGGTCTAGTTTATAGC
 
. : . : . : . : . : . :
rJMSF021N05- CAAGTGAATTAAGAATCCGGAGTGCATTCTTGGTCACCTTACTTTCCACCACAGGCCTCA
JMFN036C08+ CAAGTGAATTAAGAATCCGGAGTGCATTCTTGCTCACCTTACTTTCCACCACAGGCCTCA
JMFF051I15+ CAAGTGAATTAAGAATCCGGAGTGCATTCTTGCTCACCTTACTTTCCACCACAGGCCTCA
JMFF050C06+ CAAGTGAATTAAGAATCCGGAGTGCATTCTTGCTCACCTTACTTTCCACCACAGGCCTCA
JMSF021N05+ CAAGTGAATTAAGAATCCGGAGTGCATTCTTGGTCACCTTACTTTCCACCACAGGCCTCA
                      ____________________________________________________________
consensus CAAGTGAATTAAGAATCCGGAGTGCATTCTTGGTCACCTTACTTTCCACCACAGGCCTCA
 
. : . : . : . : . : . :
rJMSF021N05- CCAGGACTGAGATCTGATCAGCAACAGCACCTCTCATTGCACCACCCACATGTCGAACAG
JMFN036C08+ CCAGGACTGAGATCTGATCAGCAACAGCACCTCTCATTGCACCACCCACATGTCGAACAG
JMFF051I15+ CCAGGACTGAGATCTGATCAGCAACAGCACCTCTCATTGCACCACCCACATGTCGAACAG
JMFF050C06+ CCAGGACTGAGATCTGATCAGCAACAGCACCTCTCATTGCACCACCCACATGTCGAACAG
JMSF021N05+ CCAGGACTGAGATCTGATCAGCAACAGCACCTCTCATTGCACCACCCACATGTCGAACAG
                      ____________________________________________________________
consensus CCAGGACTGAGATCTGATCAGCAACAGCACCTCTCATTGCACCACCCACATGTCGAACAG
 
. : . : . : . : . : . :
rJMSF021N05- TCCATGTGGGTTCAGA
JMFN036C08+ TCCATGTGGGTTCAGATTGTTCAAGATCACATATGAGGCGAATTTCCGACGACACTAACC
JMFF051I15+ TCCATGTGGGTTCAGATTGTTCAAGATCACATATGAGGCGAATTTCCGACGACACTAACC
JMFF050C06+ TCCATGTGGGTTCAGATTGTTCAAGATCACATATGAGGCGAATTTCCGACGACACTAACC
JMSF021N05+ TCCATGTGGGTTCAGATTGTTCAAGATCACATATGAGGCGAATTTCCGACGACACTAACC
                      ____________________________________________________________
consensus TCCATGTGGGTTCAGATTGTTCAAGATCACATATGAGGCGAATTTCCGACGACACTAACC
 
. : . : . : . : . : . :
JMFN036C08+ CTAGGTTTGCAACGCTTTTGAGGCATAATTCATGTATGCATAGCCTTTCTTTACGAACAC
JMFF051I15+ CTAGGTTTGCAACGCTTTTGAGGCATAATTCATGTATGCATAGCCTTTCTTTACGAGTAC
JMFF050C06+ CTAGGTTTGCAACGCTTTTGAGGCATAATTCATGTATGCATAGCCTTTCTTTACGAACAC
JMSF021N05+ CTAGGTTTGCAACGCTTTTGAGGCATAATTCATGTATGCATAGCCTTTCTTTACGAACAC
                      ____________________________________________________________
consensus CTAGGTTTGCAACGCTTTTGAGGCATAATTCATGTATGCATAGCCTTTCTTTACGAACAC
 
. : . : . : . : . : . :
JMFN036C08+ CACAAAGTCCGTGAAGTAGAATCTCAAGAGCCTCAACATGTTGCGT-CTCG-ATAATTCC
JMFF051I15+ CACAAAGTCCGTGAAGTAGAATCTCAAGAGCCTCAGTAGTTTGCGTGTTCGTATGATTCC
JMFF050C06+ CACAAAGTCCGTGAAGTAGAATCTCAAGAGCCTCAACATGTTGCGT-CTCG-ATAATTCC
JMSF021N05+ CACAAAGTCCGTGAAGTAGAATCTCAAGAGCCTCAACATGTTGCGT-CTCG-ATAATTCC
                      ____________________________________________________________
consensus CACAAAGTCCGTGAAGTAGAATCTCAAGAGCCTCAACATGTTGCGT-CTCG-ATAATTCC
 
. : . : . : . : . : . :
JMFN036C08+ CTGAACTACGCACTCCATTCTCAGTCGCCGAGACCCGAAC
JMFF051I15+ CTGAACTACGCACTCCATTGTCAGTCGCCGAGACCCGAACAATCTGCCC
JMFF050C06+ CTGAACTACGCACTCCATTCTCAGTCGCCGAGACCCGAACAATCTGCCCTAACACC
JMSF021N05+ CTGAACTACGCACTCCATTCTCAGTCGCCGAGACCCGAACAATCTGCCCTAGCACCGTTC
                      ____________________________________________________________
consensus CTGAACTACGCACTCCATTCTCAGTCGCCGAGACCCGAACAATCTGCCCTAGCACCGTTC