Previous Contig 006010:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009K20Sequence277018636781006010 (3)gb:AP003874_18346536e-95Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMSF021L04Sequence528006010 (3)gb:AP003874_18346532e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11289006010 (3)gb:AP003874_18346539e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009K20+ GGATTGAACCAAAGATTGAGCATTATGGCTGCATGGTAAATCTTC
                      ____________________________________________________________
consensus GGATTGAACCAAAGATTGAGCATTATGGCTGCATGGTAAATCTTC
 
. : . : . : . : . : . :
rJMSF009K20+ TTGGCCGAGCTGGACATTTACAAGAGGCATACGAGTTTATTAGAAGTATGAAGATAGACC
                      ____________________________________________________________
consensus TTGGCCGAGCTGGACATTTACAAGAGGCATACGAGTTTATTAGAAGTATGAAGATAGACC
 
. : . : . : . : . : . :
rJMSF009K20+ CTGATCCGGTTTTATGGGGAACATTACTTGGTGCCTGTAGGATTCATAGAGACATCAAGC
                      ____________________________________________________________
consensus CTGATCCGGTTTTATGGGGAACATTACTTGGTGCCTGTAGGATTCATAGAGACATCAAGC
 
. : . : . : . : . : . :
rJMSF009K20+ TGGGAGAGAAAATTGTGGAATTCCTTGTAGAATGCAATCTCGCAAATTCTGGAACATATG
                      ____________________________________________________________
consensus TGGGAGAGAAAATTGTGGAATTCCTTGTAGAATGCAATCTCGCAAATTCTGGAACATATG
 
. : . : . : . : . : . :
rJMSF009K20+ TTCTGCTCTCCAACATATACGCTGCAGCTGGAGATTGGGATGGGGCTGCAAAGGTGAGGG
                      ____________________________________________________________
consensus TTCTGCTCTCCAACATATACGCTGCAGCTGGAGATTGGGATGGGGCTGCAAAGGTGAGGG
 
. : . : . : . : . : . :
rJMSF009K20+ CAATGATGAAGAAAAGCGGGGTCGAGAAGGAGCCAGGTTGCAGCTCAATTGAGGTGAATA
                      ____________________________________________________________
consensus CAATGATGAAGAAAAGCGGGGTCGAGAAGGAGCCAGGTTGCAGCTCAATTGAGGTGAATA
 
. : . : . : . : . : . :
rJMSF009K20+ ACAAGGTACATGAGTTCCTTGCCGGCGACATGAAACACCCTAAGACCAAAGAGATTTACT
                      ____________________________________________________________
consensus ACAAGGTACATGAGTTCCTTGCCGGCGACATGAAACACCCTAAGACCAAAGAGATTTACT
 
. : . : . : . : . : . :
rJMSF009K20+ CTATGCTCGAGGAAATCAACAGGTGGCTCGAGACTCATGGTTACACTCCACAAACCGACA
JMSF021L04- AAATCAACAGGTGGCTCGAGACTCATGGTTACACTCCACAAACCGACA
                      ____________________________________________________________
consensus CTATGCTCGAGGAAATCAACAGGTGGCTCGAGACTCATGGTTACACTCCACAAACCGACA
 
. : . : . : . : . : . :
rJMSF009K20+ TTGTATTGCATGACATCGGGGAGTCAGAGAAGCAGAAATCCCTGGCTGTTCACAGTGAAA
JMSF021L04- TTGTATTGCATGACATCGGGGAGTCAGAGAAGCAGAAATCCCTGGCTGTTCACAGTGAAA
                      ____________________________________________________________
consensus TTGTATTGCATGACATCGGGGAGTCAGAGAAGCAGAAATCCCTGGCTGTTCACAGTGAAA
 
. : . : . : . : . : . :
rJMSF009K20+ AACTTGCCATTGCGTTTGGACTGATAAGCACTCAGCCCGGAACTACAATCAAGATTGTCA
rJMSF021L04+ TGATAANCANTCAGCCCGGAANTACAATCAAGATTGTCA
JMSF021L04- AACTTGCCATTGCGTTTGGACTGATAAGCACTCAGCCCGGAACTACAATCAAGATTGTCA
                      ____________________________________________________________
consensus AACTTGCCATTGCGTTTGGACTGATAAGCACTCAGCCCGGAACTACAATCAAGATTGTCA
 
. : . : . : . : . : . :
rJMSF009K20+ AAAACCTTCGGGTGTGCCAAGACTGTCATGCCGTGTCCAAACTTATCTCCAAGATCACAG
rJMSF021L04+ AAAACCTTCGGGTGTGCCANGACTGTCATGCCGTGTCCAAACTTATNTCCAAGATCACAG
JMSF021L04- AAAACCTTCGGGTGTGCCAAGACTGTCATGCCGTGTCCAAACTTATCTCCAAGATCACAG
                      ____________________________________________________________
consensus AAAACCTTCGGGTGTGCCAAGACTGTCATGCCGTGTCCAAACTTATCTCCAAGATCACAG
 
. : . : . : . : . : . :
rJMSF009K20+ GCAGGAAACTCATTGTTAGAGACCGGAATCGCTTCCACCATTTCGAGAATGGTTCGTGTT
rJMSF021L04+ GCAGGAAACTCATTGTTNGAGACCGGAATCGCTTCCACCATTTCGAGAATGGTTCGTGTT
JMSF021L04- GCAGGAAACTCATTGTTAGAGACCGGAATCGCTTCCACCATTTCGAGAATGGTTCGTGTT
                      ____________________________________________________________
consensus GCAGGAAACTCATTGTTAGAGACCGGAATCGCTTCCACCATTTCGAGAATGGTTCGTGTT
 
. : . : . : . : . : . :
rJMSF009K20+ CTTGCGGTGATTACTGGTAATTTTTATTTATTGAGCGTAAAATATATAGTCTCACTATCT
rJMSF021L04+ CTTGCGGTGATTACTGGTAATTTTTATTTATTGAGCGTAAAATATATAGTCTCACTATCT
JMSF021L04- CTTGCGGTGATTACTGGTAATTTTTATTTATTGAGCGTAAAATATATAGTCTCACTATCT
                      ____________________________________________________________
consensus CTTGCGGTGATTACTGGTAATTTTTATTTATTGAGCGTAAAATATATAGTCTCACTATCT
 
. : . : . : . : . : . :
rJMSF009K20+ GCT
rJMSF021L04+ GCTTAAACGCAAACGCAATCTTCAATTCTATCTTCAGAAGCTTCTTTGCTAATAATTTGT
JMSF021L04- GCTTAAACGCAAACGCAATCTTCAATTCTATCTTCAGAAGCTTCTTTGCTAATAATTTGT
                      ____________________________________________________________
consensus GCTTAAACGCAAACGCAATCTTCAATTCTATCTTCAGAAGCTTCTTTGCTAATAATTTGT
 
. : . : . : . : . : . :
rJMSF021L04+ ATAGTTGCT
JMSF021L04- ATAGTTGCTATCATGTTATTATTACTAGCCAGCCATGACTCAGGAGAGATACCCTTTGGT
                      ____________________________________________________________
consensus ATAGTTGCTATCATGTTATTATTACTAGCCAGCCATGACTCAGGAGAGATACCCTTTGGT
 
. : . : . : . : . : . :
JMSF021L04- TAAATATGTAGAATGAAAATGTAGACATTTTTAAAAAAAATAATTTATTAAAAATTATTC
                      ____________________________________________________________
consensus TAAATATGTAGAATGAAAATGTAGACATTTTTAAAAAAAATAATTTATTAAAAATTATTC