Previous Contig 006009:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001J18Sequence551006009 (49)gb:AB002147_15086952e-67Nicotiana excelsior mRNA for water channel protein, complete cds.767006009 (49)gb:AY547266_16129761e-97Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFF004C13Sequence496006009 (49)gb:AB002147_15086955e-59Nicotiana excelsior mRNA for water channel protein, complete cds.720006009 (49)gb:AF452011_18008394e-65Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete cds.
JMFF004C14Sequence107006009 (49)gb:AY547266_16129762e-14Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFF004E09Sequence556006009 (49)gb:AB002147_15086958e-70Nicotiana excelsior mRNA for water channel protein, complete cds.723006009 (49)gb:AY547266_16129766e-87Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFF005C24Sequence451006009 (49)gb:AB002147_15086952e-50Nicotiana excelsior mRNA for water channel protein, complete cds.
JMFF006N20Sequence541006009 (49)gb:AB002147_15086958e-66Nicotiana excelsior mRNA for water channel protein, complete cds.769006009 (49)gb:AY547266_16129762e-84Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFF006P18Sequence540006009 (49)gb:AB002147_15086952e-66Nicotiana excelsior mRNA for water channel protein, complete cds.767006009 (49)gb:AF452011_18008393e-86Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete cds.
JMFF010O01Sequence548006009 (49)gb:AB002147_15086952e-69Nicotiana excelsior mRNA for water channel protein, complete cds.687006009 (49)gb:AY547266_16129762e-77Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFF015E18Sequence553006009 (49)gb:AB002147_15086951e-68Nicotiana excelsior mRNA for water channel protein, complete cds.731006009 (49)gb:AF452011_18008399e-79Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete cds.
JMFF020B16Sequence551006009 (49)gb:AB002147_15086952e-67Nicotiana excelsior mRNA for water channel protein, complete cds.668006009 (49)gb:AY547266_16129762e-75Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFF025C21Sequence559006009 (49)gb:AB002147_15086953e-70Nicotiana excelsior mRNA for water channel protein, complete cds.709006009 (49)gb:AY547266_16129762e-88Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFF030H18Sequence509006009 (49)gb:AB002147_15086951e-75Nicotiana excelsior mRNA for water channel protein, complete cds.648006009 (49)gb:AY547266_16129762e-75Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFF035A17Sequence551006009 (49)gb:AB002147_15086956e-68Nicotiana excelsior mRNA for water channel protein, complete cds.708006009 (49)gb:AY547266_16129766e-71Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFF039K09Sequence176006009 (49)gb:AJ605574_18119213e-17Ricinus communis mRNA for aquaporin (Pip1-1 gene), clone pP2L.
JMFF040K24Sequence569006009 (49)gb:AB002147_15086953e-72Nicotiana excelsior mRNA for water channel protein, complete cds.747006009 (49)gb:AF452011_18008393e-78Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete cds.
JMFF041B09Sequence652006009 (49)gb:AF452011_18008393e-87Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete cds.609021600gb:AY547266_16129762e-46Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFF045O09Sequence623006009 (49)gb:AB002147_15086951e-79Nicotiana excelsior mRNA for water channel protein, complete cds.528006009 (49)gb:AY547266_16129768e-37Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFN007C05Sequence637006009 (49)gb:AF452011_18008391e-90Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete cds.
JMFN009A01Sequence632006009 (49)gb:AF452011_18008393e-87Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete cds.
JMFN012C20Sequence596006009 (49)gb:AB002147_15086957e-81Nicotiana excelsior mRNA for water channel protein, complete cds.
JMFN012F11Sequence627006009 (49)gb:AF452011_18008395e-85Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete cds.
JMFN018J04Sequence626006009 (49)gb:AY547266_1612976e-107Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFN028I03Sequence292006009 (49)gb:AF067184_17655986e-46Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds.
JMFN030E07Sequence453006009 (49)gb:AY547266_16129768e-27Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFN031A24Sequence358006009 (49)gb:AF067184_17655982e-31Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds.
JMFN044F17Sequence619006009 (49)gb:AB002147_15086954e-82Nicotiana excelsior mRNA for water channel protein, complete cds.
JMFN044L12Sequence628006009 (49)gb:AY547266_16129763e-62Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMFS025B09Sequence606006009 (49)gb:AB002147_15086953e-83Nicotiana excelsior mRNA for water channel protein, complete cds.
JMSF021K24Sequence680006009 (49)gb:AB002147_15086954e-57Nicotiana excelsior mRNA for water channel protein, complete cds.729006009 (49)gb:AY547266_16129762e-88Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMSF021L02Sequence679006009 (49)gb:AF452011_18008391e-91Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete cds.734006009 (49)gb:AY547266_16129765e-93Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMSF028E23Sequence623006009 (49)gb:AB002147_15086953e-81Nicotiana excelsior mRNA for water channel protein, complete cds.674006009 (49)gb:AY547266_16129764e-83Ipomoea nil aquaporin-like protein mRNA, partial cds.
JMSF052K23Sequence625006009 (49)gb:AB002147_15086954e-82Nicotiana excelsior mRNA for water channel protein, complete cds.932006009 (49)gb:AF452011_1800839e-118Petunia x hybrida aquaporin-like protein (PIP1;2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045O09- ACCCTGGAGAGXXXXXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus ACCCTGGAGAGNNNNNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFN030E07+ GAGAGCAATACTTTTATTTGAACAACCTCAAGATTACAGAACAAACATACAAA
rJMFF045O09- XXXXXXXGAGAGCAATACTTTTATTTGAACAACCTCAAGATTACAGAACAAACATACAAA
JMFN044L12+ GAGAGCAATAC-TTTATTTGAACAACCTCAAGATTACAGAACAAACATACAAA
rJMFF035A17- TACTTTTATTTGAACAACCTCAAGATTACAGAACAAACATACAAA
rJMFF004C13- ATACTTTTATTTGAACAACCTCAAGATTACAGAACAAACATACAAA
rJMFF040K24- TACTTTTATTTGAACAACCTCAAGATTACAGAACAAACATACAAA
rJMFF015E18- CCTCAAGATTACAGAACAAACATACAAA
rJMFF020B16- ACCTCAAGATTACAGAACAAACATACAAA
rJMFF010O01- TACTTTTATTTGAACAACCTCAAGATTACAGAACAAACATACAAA
rJMFF006N20- TACTTTTATTTGAACAACCTCAAGATTACAGAACAAACATACAAA
rJMSF021K24- CAGAACAAACATACAAA
rJMFF001J18- AGATTACAGAACAAACATACAAA
rJMFF006P18- AGATTACAGAACAAACATACAAA
rJMSF021L02- AACATACAAA
rJMFF030H18- ACAAACATACAAA
rJMFF004E09- AGATTACAGAACAAACATACAAA
rJMSF028E23- AAA
rJMFF025C21- AACATACAAA
rJMSF052K23- AGATTACAGAACAAACATACAAA
                      ____________________________________________________________
consensus NNNNNNNGAGAGCAATACTTTTATTTGAACAACCTCAAGATTACAGAACAAACATACAAA
 
. : . : . : . : . : . :
JMFN030E07+ TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF045O09- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAAA
JMFN044L12+ TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF035A17- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF004C13- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF040K24- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF015E18- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF020B16- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF010O01- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF006N20- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMSF021K24- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF001J18- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF006P18- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMSF021L02- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF030H18- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF004E09- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMSF028E23- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMFF025C21- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
rJMSF052K23- TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
                      ____________________________________________________________
consensus TTATACAAACGCCCAACTGTTTAACTCTTTTGGACTTTAATGAAAAGCAAATGTCCTAGA
 
. : . : . : . : . : . :
JMFN030E07+ GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF045O09- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
JMFN044L12+ GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF035A17- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF004C13- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF040K24- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF015E18- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF020B16- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF010O01- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCCCTGC
rJMFF006N20- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMSF021K24- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF001J18- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF006P18- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMSF021L02- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF030H18- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF004E09- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMSF028E23- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMFF025C21- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
rJMSF052K23- GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
                      ____________________________________________________________
consensus GATAACAAGCAACATGTTCCAATAATTGAATTGAGGTTGTCTTGTCCTTTATCTCTCTGC
 
. : . : . : . : . : . :
JMFN030E07+ TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF045O09- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
JMFN044L12+ TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF035A17- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF004C13- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF040K24- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF015E18- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF020B16- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF010O01- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF006N20- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMSF021K24- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF001J18- TCCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF006P18- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMSF021L02- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF030H18- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF004E09- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMSF028E23- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
rJMFF025C21- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
JMFN018J04+ TCAATAATGGAGAA
rJMSF052K23- TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
                      ____________________________________________________________
consensus TTCATTTCATCGCCAGCCACAAGAAAATTAGGCAAAATAAAAGGCTTCAATAATGGAGAA
 
. : . : . : . : . : . :
JMFN030E07+ CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF045O09- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
JMFN044L12+ CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF035A17- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF004C13- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF040K24- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF015E18- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF020B16- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF010O01- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF006N20- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMSF021K24- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF001J18- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF006P18- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMSF021L02- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF030H18- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF004E09- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMSF028E23- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF025C21- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMFF004C14- GATGACTTGAATGGGATGGCTCT
JMFN018J04+ CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
rJMSF052K23- CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
                      ____________________________________________________________
consensus CAGTACAATTGAAGAAGATGATAAGTAGTCGGATCAGGATGACTTGAATGGGATGGCTCT
 
. : . : . : . : . : . :
JMFN030E07+ GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF045O09- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
JMFN044L12+ GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF035A17- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF004C13- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF040K24- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF015E18- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF020B16- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF010O01- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF006N20- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMSF021K24- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF001J18- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF006P18- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMSF021L02- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF030H18- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF004E09- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMSF028E23- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF025C21- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMFF004C14- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCANCCCAGAA
JMFN018J04+ GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
rJMSF052K23- GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
                      ____________________________________________________________
consensus GATCACAACCTGGTGGTACAGTGCAGCCAGTGCTGCCCCAACAAATGGTCCAACCCAGAA
 
. : . : . : . : . : . :
JMFN030E07+ GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF045O09- AATCCAATGATCATTCCATGCGTGTTCATTGTTGTAAATGATGGCTGCACCGAGACTTCG
JMFN044L12+ GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF035A17- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF004C13- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF040K24- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF015E18- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF020B16- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF010O01- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF006N20- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMSF021K24- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF001J18- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF006P18- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMSF021L02- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF030H18- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF004E09- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMSF028E23- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF025C21- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMFF004C14- GATCCAATGATCATTCCATGCGTG
JMFN018J04+ GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
rJMSF052K23- GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
                      ____________________________________________________________
consensus GATCCAATGATCATTCCATGCGTGTTCATTGTTGTAGATGATGGCTGCACCGAGACTTCG
 
. : . : . : . : . : . :
JMFN030E07+ GGCCGGGTTAATACCCGTGCCGGTGATC
rJMFF045O09- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
JMFN044L12+ GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF035A17- GGCCGGGTTA--ACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF004C13- GGCCGGGTTA--ACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF040K24- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF015E18- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF020B16- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF010O01- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF006N20- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMSF021K24- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF001J18- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF006P18- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMSF021L02- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF030H18- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF004E09- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMSF028E23- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMFF025C21- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
JMFN018J04+ GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
rJMSF052K23- GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
                      ____________________________________________________________
consensus GGCCGGGTTAATACCCGTGCCGGTGATCGGAATGGTAGCCAAGTGCACCAAGAAGACGGC
 
. : . : . : . : . : . :
rJMFF045O09- GAACCCAATGGGCAACGG
JMFN044L12+ GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF035A17- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF004C13- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF040K24- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF015E18- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF020B16- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF010O01- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF006N20- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMSF021K24- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF001J18- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF006P18- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMSF021L02- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF030H18- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF004E09- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMSF028E23- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMFF025C21- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
JMFN018J04+ GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
rJMSF052K23- GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
                      ____________________________________________________________
consensus GAACCCAATGGGCAACGGTGCCAACACAGGGACATGGGAGTCTCTGGCGTTGCGTTTGGC
 
. : . : . : . : . : . :
JMFN044L12+ ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF035A17- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF004C13- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF040K24- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF015E18- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF020B16- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF010O01- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF006N20- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMSF021K24- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF001J18- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF006P18- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMSF021L02- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF030H18- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF004E09- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMSF028E23- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMFF025C21- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
JMFN018J04+ ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
rJMSF052K23- ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
JMFN007C05+ GAACAAAGGTGCCGACAATCTCGGCGCCGAG
JMSF021L02+ GTAANCAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
JMFN009A01+ TCTCGGCGCCGAG
JMFN012F11+ G
JMFN044F17+ GAG
JMFF041B09+ TCTCGGCGCCGAG
                      ____________________________________________________________
consensus ATCAGTGGCGGAGAAGACGGTGTAAACAAGAACAAAGGTGCCGACAATCTCGGCGCCGAG
 
. : . : . : . : . : . :
JMFN044L12+ GCCGTCGCCTTTGGTGTATCCGGGG-TTTA
rJMFF035A17- GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMFF004C13- GCCGTCGCCTTTGGTGTATCCGGGGTTTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMFF040K24- GCCGTCGCCTTTGGTGTATCCGGGGTTTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMFF015E18- GCCGTCGCCTTTGGTGTATCCGGGGTTTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMFF020B16- GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMFF010O01- GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMFF006N20- GCCGTCGCCTTTGGTGTATCCGGGGTTTTACNACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMSF021K24- GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMFF001J18- GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMFF006P18- GCCGTCGCCTTTGGTGTATCCGGGGTTTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMSF021L02- GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMFF030H18- GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMFF004E09- GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMSF028E23- GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMFF025C21- GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMFN018J04+ GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
rJMSF052K23- GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMFN007C05+ GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMSF021L02+ GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMFN009A01+ GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMFN012F11+ GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMSF052K23+ GTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMFF045O09+ TATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMFS025B09+ TTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMFN044F17+ GCCGTCGCCTTTGG-GTATCCGGGG-TTACNAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMFN012C20+ CGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMFF030H18+ GGAGTTGT
JMFF041B09+ GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
JMSF028E23+ ATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
                      ____________________________________________________________
consensus GCCGTCGCCTTTGGTGTATCCGGGG-TTTACAACGTTGGCGCCGCCGCCTTTGGAGTTGT
 
. : . : . : . : . : . :
rJMFF035A17- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCANATCGCCCCCAGACACTGCA
rJMFF004C13- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
rJMFF040K24- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
rJMFF015E18- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
rJMFF020B16- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGC
rJMFF010O01- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGAT
rJMFF006N20- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCANACACTGCA
rJMSF021K24- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
rJMFF001J18- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
rJMFF006P18- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
rJMSF021L02- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
rJMFF030H18- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGC
rJMFF004E09- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCANATCGCCCCCAGACACTGCA
rJMSF028E23- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
rJMFF025C21- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFN018J04+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
rJMSF052K23- ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFN007C05+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMSF021L02+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFN009A01+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFN012F11+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMSF052K23+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFF045O09+ ACAGCGTCTTCCGGAGCCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFS025B09+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFN044F17+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFN012C20+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFF030H18+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFF041B09+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFF040K24+ CCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFF025C21+ TCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFF015E18+ CGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFF010O01+ GCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFF035A17+ CCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFF006P18+ GATCGCCCCCAGACACTGCA
JMFF020B16+ CCACGCCGGC-CCGCAGATCGCCCCCAGACACTGCA
JMFF004E09+ CCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFF001J18+ CCGGCGCCGCAGATCGCCCCCAGACACTGCA
JMFF006N20+ AGATCGCCCCCAGACACTGCA
JMSF028E23+ ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
                      ____________________________________________________________
consensus ACAGCGTCTTTCCGAACCCCTTCACCACGCCGGCGCCGCAGATCGCCCCCAGACACTGCA
 
. : . : . : . : . : . :
rJMFF035A17- TCACAA
rJMFF004C13- TCACAATGTAGTACAC
rJMFF040K24- TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAG
rJMFF015E18- TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGC
rJMFF006N20- TCACAATGTANTACACCAGCCTAGTCAACGACACTTTCCGANCCANAAACAGCCCGAACG
rJMSF021K24- TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCG
rJMFF001J18- TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
rJMFF006P18- TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCANAAACAGCCCGAACG
rJMSF021L02- TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
rJMFF004E09- TCACAATGTANTACACCAGCCTAGTCAACGACACTTTCCGA
rJMSF028E23- TCACAATGTAGT
rJMFF025C21- TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCG
JMFN018J04+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
rJMSF052K23- TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFN007C05+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMSF021L02+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFN009A01+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFN012F11+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMSF052K23+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF045O09+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFS025B09+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFN044F17+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFN012C20+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF030H18+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF041B09+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF040K24+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF025C21+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF015E18+ TCACAATGTAGTACACCAGCNTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF010O01+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF035A17+ TCACAATGTAGTACACCAGCNTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF006P18+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF020B16+ TCACAATGTAGTACACCAGCCTAGTCGACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF004E09+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF001J18+ TCACAATGTAGTACACCAGCNTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF006N20+ TCACAATGTAGTACACCAGCNTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFN028I03+ GACACTTTCCGAGCCAGAAACAGCCCGAACG
JMFF004C13+ TCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMSF028E23+ TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
JMSF021K24+ TCCGAGCCAGAAACAGCCCGAACG
                      ____________________________________________________________
consensus TCACAATGTAGTACACCAGCCTAGTCAACGACACTTTCCGAGCCAGAAACAGCCCGAACG
 
. : . : . : . : . : . :
rJMFF006N20- TTAC
rJMFF001J18- TTACCGCCGGATTAATATGCCCCCC
rJMFF006P18- TTACCGCCGGATTAATATGCCCCC
rJMSF021L02- TTACC
JMFN018J04+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
rJMSF052K23- TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFN007C05+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMSF021L02+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFN009A01+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFN012F11+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMSF052K23+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF045O09+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFS025B09+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFN044F17+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFN012C20+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF030H18+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF041B09+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF040K24+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF025C21+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF015E18+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF010O01+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF035A17+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF006P18+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF020B16+ TTACCGCCGGATTAATGTGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF004E09+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF001J18+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF006N20+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFN028I03+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF004C13+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMSF028E23+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMFF005C24+ TAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
JMSF021K24+ TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
                      ____________________________________________________________
consensus TTACCGCCGGATTAATATGCCCCCCGGAGATGCCGGCGGTGCAGTAAACGAGGGCGAAGA
 
. : . : . : . : . : . :
JMFN018J04+ TCATGCCGCCGAA
rJMSF052K23- TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFN007C05+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMSF021L02+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFN009A01+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFN012F11+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMSF052K23+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF045O09+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFS025B09+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFN044F17+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFN012C20+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF030H18+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF041B09+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF040K24+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF025C21+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF015E18+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF010O01+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF035A17+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF006P18+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF020B16+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF004E09+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF001J18+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF006N20+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFN031A24+ CCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFN028I03+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF004C13+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMSF028E23+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMFF005C24+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
JMSF021K24+ TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
                      ____________________________________________________________
consensus TCATGCCGCCGAAGGCCCAAGCGATGCCCTGAATGCCGACGGTTTTGCATTTGGAGTCGG
 
. : . : . : . : . : . :
rJMSF052K23- ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGGAAAAAGGAAGGTGGCTATG
JMFN007C05+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMSF021L02+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFN009A01+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFN012F11+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMSF052K23+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF045O09+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFS025B09+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFN044F17+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFN012C20+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF030H18+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF041B09+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF040K24+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF025C21+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF015E18+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF010O01+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF035A17+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF006P18+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF020B16+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF004E09+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF001J18+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGGTGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF006N20+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFN031A24+ ATCTGGTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFN028I03+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF039K09+ CGCCCATGNCGGTGAGAATGGNGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF004C13+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMSF028E23+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMFF005C24+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
JMSF021K24+ ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
                      ____________________________________________________________
consensus ATTTGCTGACGCCCATGACGGTGAGAATGGTGATGTAAAGG-AAGAGGAAGGTGGCTATG
 
. : . : . : . : . : . :
rJMSF052K23- AA
JMFN007C05+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMSF021L02+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFN009A01+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFN012F11+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMSF052K23+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF045O09+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFS025B09+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFN044F17+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFN012C20+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF030H18+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF041B09+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF040K24+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF025C21+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF015E18+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF010O01+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF035A17+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF006P18+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF020B16+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF004E09+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF001J18+ AACTCGGCGATCCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF006N20+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFN031A24+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFN028I03+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF039K09+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF004C13+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMSF028E23+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMFF005C24+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
JMSF021K24+ AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
                      ____________________________________________________________
consensus AACTCGGCGATTCCGGCGCGGTAAAAGGACCACGAGGAGAGCTCGCTGGGCTCGAACAGC
 
. : . : . : . : . : . :
JMFN007C05+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMSF021L02+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFN009A01+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFN012F11+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMSF052K23+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF045O09+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFS025B09+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFN044F17+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFN012C20+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF030H18+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF041B09+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF040K24+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF025C21+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF015E18+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF010O01+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF035A17+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF006P18+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF020B16+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF004E09+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF001J18+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF006N20+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFN031A24+ GCCGTCGGCGGTGCCTGCCGTGTAGTCCCTTGTCTTGCGCCGCCGTA-CCGATGGCTTGC
JMFN028I03+ GCCGTCGGCGGTGCCT-CCGTG
JMFF039K09+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTGACCGATGGCTTGC
JMFF004C13+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMSF028E23+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMFF005C24+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
JMSF021K24+ GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
                      ____________________________________________________________
consensus GCCGTCGGCGGTGCCT-CCGTGTAGT-CCTTGTCTTGCGCCGCCGTG-CCGATGGCTTGC
 
. : . : . : . : . : . :
JMFN007C05+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMSF021L02+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFN009A01+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFN012F11+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMSF052K23+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF045O09+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFS025B09+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFN044F17+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFN012C20+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF030H18+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF041B09+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF040K24+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF025C21+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF015E18+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF010O01+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF035A17+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF006P18+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF020B16+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF004E09+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF001J18+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF006N20+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFN031A24+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTATTCTCTGTGCGCTATCCTCAGC
JMFF039K09+ TTCTCC
JMFF004C13+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMSF028E23+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMFF005C24+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
JMSF021K24+ TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
                      ____________________________________________________________
consensus TTCTCCGGGAACTTGTTGGCCCCCAATCTCACATCCTCTTCTCTGTGCTCCATCCTCAGC
 
. : . : . : . : . : . :
JMFN007C05+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMSF021L02+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFN009A01+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFN012F11+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMSF052K23+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF045O09+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFS025B09+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFN044F17+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFN012C20+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF030H18+ TCTTCGATTGATCTACCAAATTATT
JMFF041B09+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF040K24+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF025C21+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF015E18+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF010O01+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF035A17+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF006P18+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF020B16+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF004E09+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF001J18+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF006N20+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFN031A24+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGCTTAACGTA
JMFF004C13+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMSF028E23+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMFF005C24+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
JMSF021K24+ TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
                      ____________________________________________________________
consensus TCTTCGATTGATCTACCAAATTATTACCAAGAAAATGAGAGTTCTGCAAAGTTTAACGTT
 
. : . : . : . : . : . :
JMFN007C05+ GAACGTTGGGT
JMSF021L02+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAG
JMFN009A01+ GAACGTTGGGTGAAATTGTTGCAA
JMFN012F11+ GAACGTTGGGTGAAATTGTTGCAATAATGGA
JMSF052K23+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAG
JMFF045O09+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAGT
JMFS025B09+ GAACGTTGGGTGAAATTGTT
JMFN044F17+ GAACGTTGGGTGAAATTGTTGC
JMFN012C20+ GAACGTTGGGTGAAATTGTTG
JMFF041B09+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAGT
JMFF040K24+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAAAGAGT
JMFF025C21+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAGT
JMFF015E18+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAGT
JMFF010O01+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAAT
JMFF035A17+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAGT
JMFF006P18+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAGT
JMFF020B16+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAAT
JMFF004E09+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAGT
JMFF001J18+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAAAGAGT
JMFF006N20+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAAAGAGT
JMFN031A24+ GAACG
JMFF004C13+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAGT
JMSF028E23+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAGT
JMFF005C24+ GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAGT
JMSF021K24+ GAACGTTGGGTGAAATTGCTGCAATAATGGAGGGGGGAATGAGTGAGGAGTATCATCAAT
                      ____________________________________________________________
consensus GAACGTTGGGTGAAATTGTTGCAATAATGGAGGGGGGAATGAGTGAGGAGTATCATCAAT
 
. : . : . : . : . : . :
JMSF021K24+ GGTGTACGTATATATATGACTTTTTGGGTGGAGTGGGGGGGCCTATGAGGTGTTACAATG
                      ____________________________________________________________
consensus GGTGTACGTATATATATGACTTTTTGGGTGGAGTGGGGGGGCCTATGAGGTGTTACAATG
 
. : . : . : . : . : . :
JMSF021K24+ ATACAAGTTTCATTATCATGCCAACCGACCATGTATAATTCAGTCTCTGATGAATACTTT
                      ____________________________________________________________
consensus ATACAAGTTTCATTATCATGCCAACCGACCATGTATAATTCAGTCTCTGATGAATACTTT
 
. : . : . : . : . : . :
JMSF021K24+ TTTTCATGTGAGAGATATATGTATATGGACTATAGTGCTGCAATTTCTTTGGAAAAGTTT
                      ____________________________________________________________
consensus TTTTCATGTGAGAGATATATGTATATGGACTATAGTGCTGCAATTTCTTTGGAAAAGTTT