Previous Contig 006007:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009G21Sequence553006007 (5)gb:AY050466_15622402e-11Arabidopsis thaliana AT5g60590/muf9_240 mRNA, complete cds.>gb:AF378867_1793452 717013715 (7)gb:AB005246_15095946e-67Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24.
JMSF008F11Sequence350006007 (5)752013715 (7)gb:AB005246_15095942e-72Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24.
JMSF021K18Sequence658006007 (5)gb:AY050466_15622402e-23Arabidopsis thaliana AT5g60590/muf9_240 mRNA, complete cds.>gb:AF378867_1793452 748013715 (7)gb:AB005246_15095941e-79Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24.
JMSF022D14Sequence611006007 (5)gb:AY050466_15622401e-15Arabidopsis thaliana AT5g60590/muf9_240 mRNA, complete cds.>gb:AF378867_1793452 771013715 (7)gb:AB005246_15095947e-81Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24.
JMSF023D14Sequence634006007 (5)gb:AY050466_15622409e-19Arabidopsis thaliana AT5g60590/muf9_240 mRNA, complete cds.>gb:AF378867_1793452

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023D14+ AGGGGATTTGTATATTTACGACCTTTGATATCAT
JMSF022D14+ TTTGATATCAT
JMSF021K18+ TCAACATCACCAACACAAATTGCCAGGGGATTTGTATATTTACGACCTTTGATATCAT
                      ____________________________________________________________
consensus TCAACATCACCAACACAAATTGCCAGGGGATTTGTATATTTACGACCTTTGATATCAT
 
. : . : . : . : . : . :
JMSF023D14+ ATATACGGTTAACGGCCTCAGCAGAACAAGCGTCACAAGCAAAGCCATAGAGCGTGTCGG
JMSF022D14+ ATATACGGTTAACGGCCTCAGCAGAACAAGCGTCACAAGCAAAGCCATAGAGCGTGTCGG
JMFF009G21+ CCTCAGCAGAACAAGCGTCACAAGCAAAGCCATAGAGCGTGTCGG
JMSF021K18+ ATATACGGTTAACGGCCTCAGCAGAACAAGCGTCACAAGCAAAGCCATAGAGCGTGTCGG
                      ____________________________________________________________
consensus ATATACGGTTAACGGCCTCAGCAGAACAAGCGTCACAAGCAAAGCCATAGAGCGTGTCGG
 
. : . : . : . : . : . :
JMSF023D14+ TGGGGACAGCAATAACATTCCCAGACTTGATAGCTTCAATTGCAGCTTCAGCATAATCCT
JMSF022D14+ TGGGGACAGCAATAACATTCCCAGACTTGATAGCTTCAATTGCAGCTTCAGCATAATCCT
JMFF009G21+ TGGGGACAGCAATAACATTCCCAGACTTGATAGCTTCAATTGCAGCTTCAGCATAATCCT
JMSF021K18+ TGGGGACAGCAATAACATTCCCAGACTTGATAGCTTCAATTGCAGCTTCAGCATAATCCT
                      ____________________________________________________________
consensus TGGGGACAGCAATAACATTCCCAGACTTGATAGCTTCAATTGCAGCTTCAGCATAATCCT
 
. : . : . : . : . : . :
JMSF023D14+ CTGTTGCTGGTTGCACCATTCCCATCCTATTAGTCTCCACTCTCAAATCCATCTTGGTTT
JMSF022D14+ CTGTTGCTGGTTGCACCATTCCCATCCTATTAGTCTCCACTCTCAAATCCATCTTGGTTT
JMFF009G21+ CTGTTGCTGGTTGCACCATTCCCATCCTATTAGTCTCCACTCTCAAATCCATCTTGGTTT
JMSF021K18+ CTGTTGCTGGTTGCACCATTCCCATCCTATTAGTCTCCACTCTCAAATCCATCTTGGTTT
                      ____________________________________________________________
consensus CTGTTGCTGGTTGCACCATTCCCATCCTATTAGTCTCCACTCTCAAATCCATCTTGGTTT
 
. : . : . : . : . : . :
JMSF023D14+ TCACACTAACCCCAACCAAGCTCCTCCTCTTGCGCTGCCCCAATTTCACAAACCCAAACT
JMSF022D14+ TCACACTAACCCCAACCAAGCTCCTCCTCTTGCGCTGCCCCAATTTCACAAACCCAAACT
JMSF008F11+ TCACACTAACCCCAACCAAGCTCNTCCTCTTGCGCTGCCCCAATTTCACAAACCCAAACT
JMFF009G21+ TCACACTAACCCCAACCAAGCTCCTCCTCTTGCGCTGCCCCAATTTCACAAACCCAAACT
JMSF021K18+ TCACACTAACCCCAACCAAGCTCCTCCTCTTGCGCTGCCCCAATTTCACAAACCCAAACT
                      ____________________________________________________________
consensus TCACACTAACCCCAACCAAGCTCCTCCTCTTGCGCTGCCCCAATTTCACAAACCCAAACT
 
. : . : . : . : . : . :
JMSF023D14+ TCCCAATCACCCCTGGGGAAGGGAGGATGAAGGGGCTGAAGAGGGGCAGCCACTGGGCAA
JMSF022D14+ TCCCAATCACCCCTGGGGAAGGGAGGATGAAGGGGCTGAAGAGGGGCAGCCACTGGGCAA
JMSF008F11+ TCCCAATCACCCCTGGGGAAGGGAGGATGAAGGGGCTGAAGAGGGGCAGCCACTGGGCAA
JMFF009G21+ TCCCAATCACCCCTGGGGAAGGGAGGATGAAGGGGCTGAAGAGGGGCAGCCACTGGGCAA
JMSF021K18+ TCCCAATCACCCCTGGGGAAGGGAGGATGAAGGGGCTGAAGAGGGGCAGCCACTGGGCAA
                      ____________________________________________________________
consensus TCCCAATCACCCCTGGGGAAGGGAGGATGAAGGGGCTGAAGAGGGGCAGCCACTGGGCAA
 
. : . : . : . : . : . :
JMSF023D14+ TTCTTATGTTTTTAGGGGTGATGTACATCAGCAAACTNTGCTTTCTTCACAGTAGCCAGT
JMSF022D14+ TTCTTATGTTTTTAGGGGTGATGTACATCAGCAAACTCTGCTTTCTTCACAGTAGCCAGT
JMSF008F11+ TTCTTATGTTTTTAGGGGTGATGTACATCAGCAAACTCTGCTTTCTTC
JMFF009G21+ TTCTTATGTTTTTAGGGGTGATGTACATCAGCAAACTCTGCTTTCTTC
JMSF021K18+ TTCTTATGTTTTTAGGGGTGATGTACATCAGCAAACTCTGCTTTCTTCACAGTAGCCAGT
                      ____________________________________________________________
consensus TTCTTATGTTTTTAGGGGTGATGTACATCAGCAAACTCTGCTTTCTTCACAGTAGCCAGT
 
. : . : . : . : . : . :
JMSF023D14+ AGCGAGAGAGGCCGGAGCTGGCCGCGCGCGGGGAGCAGGTCGCCGTCGGAGACTTGGAGT
JMSF022D14+ AGCGAGAGAGGCCGGAGCTGGCCGCGCGCGGGGAGCAGGTCGCCGTCGGAGACTTGGAGT
JMSF021K18+ AGCGAGAGAGGCCGGAGCTGGCCGCGCGCGGGGAGCAGGTCGCCGTCGGAGACTTGGAGT
                      ____________________________________________________________
consensus AGCGAGAGAGGCCGGAGCTGGCCGCGCGCGGGGAGCAGGTCGCCGTCGGAGACTTGGAGT
 
. : . : . : . : . : . :
JMSF023D14+ TCGCAGTCGCAGCAGACCGGGAGAATTGGAGAAGGCCAAACCAAACTGGAGAACTGGAGT
JMSF022D14+ TCGCAGTCGCAGCAGACCGGGAGAATTGGAGAAGGCCAAACCAAACTGGAGAACTGGAGT
JMSF021K18+ TCGCAGTCGCAGCAGACCGGGAGAATTGGAGAAGGCCAAACCAAACTGGAGAACTGGAGT
                      ____________________________________________________________
consensus TCGCAGTCGCAGCAGACCGGGAGAATTGGAGAAGGCCAAACCAAACTGGAGAACTGGAGT
 
. : . : . : . : . : . :
JMSF023D14+ TCGCAGTCGCTGGTNGGAGCCTCGGAGGTCGCCGGTCTTCCGTCTTCGNTTCGTGCCTTC
JMSF022D14+ TCGCAGTCGCTGGTCGGAGCCTCGGAGGTCGCCGGTCTTCCGTCTTCGCTTCGTGCCTTC
JMSF021K18+ TCGCAGTCGCTGGTCGGAGCCTCGGAGGTCGCCGGTCTTCCGTCTTCGCTTCGTGCCTTC
                      ____________________________________________________________
consensus TCGCAGTCGCTGGTCGGAGCCTCGGAGGTCGCCGGTCTTCCGTCTTCGCTTCGTGCCTTC
 
. : . : . : . : . : . :
JMSF023D14+ GGCCTTCGCGTTCGCACTTCGCTGAGAGTAGTCGAGAAGAGAGCCAGACAGTGAGAGA
JMSF022D14+ GGCCTTCGCGTTCGCACTTCGCTGAGAGTAGTCGAGAAGAGAGCCAGACAGTGAGAGA
JMSF021K18+ GGCCTTCGCGTTCGCACTTCGCTGAGAGTAGTCGAGAAGAGAGCCAGACAGTGAGAGACC
                      ____________________________________________________________
consensus GGCCTTCGCGTTCGCACTTCGCTGAGAGTAGTCGAGAAGAGAGCCAGACAGTGAGAGACC