Previous Contig 006003:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009L24Sequence431006003 (11)gb:AY052356_15627274e-43Arabidopsis thaliana At1g23080/T26J12_14 mRNA, complete cds.713008616 (4)gb:AF515434_18074551e-27Populus tremula x Populus tremuloides PIN1-like auxin transport protein (pin3) m
JMFS011D02Sequence626006003 (11)gb:AY052356_15627277e-85Arabidopsis thaliana At1g23080/T26J12_14 mRNA, complete cds.
JMFS016C09Sequence613006003 (11)gb:AY052356_15627278e-83Arabidopsis thaliana At1g23080/T26J12_14 mRNA, complete cds.
JMFS095C12Sequence613006003 (11)gb:AY052356_15627278e-83Arabidopsis thaliana At1g23080/T26J12_14 mRNA, complete cds.
JMFS102D06Sequence621006003 (11)gb:AY052356_15627277e-85Arabidopsis thaliana At1g23080/T26J12_14 mRNA, complete cds.
JMFS119A10Sequence619006003 (11)gb:AY052356_15627272e-83Arabidopsis thaliana At1g23080/T26J12_14 mRNA, complete cds.
JMFS150G02Sequence585006003 (11)gb:AY052356_15627279e-81Arabidopsis thaliana At1g23080/T26J12_14 mRNA, complete cds.
JMSF005M15Sequence226006003 (11)gb:AY115836_15789264e-07Medicago truncatula auxin efflux carrier protein (PIN1) gene, complete cds.
JMSF015G02Sequence232006003 (11)gb:AY115836_15789265e-08Medicago truncatula auxin efflux carrier protein (PIN1) gene, complete cds.732008616 (4)gb:AY115838_15789282e-37Medicago truncatula auxin efflux carrier protein (PIN3) gene, complete cds.
JMSF017E02Sequence237006003 (11)gb:AY115836_15789267e-10Medicago truncatula auxin efflux carrier protein (PIN1) gene, complete cds.674008616 (4)gb:AY115838_15789281e-41Medicago truncatula auxin efflux carrier protein (PIN3) gene, complete cds.
JMSF021K08Sequence676006003 (11)gb:AY052356_15627275e-89Arabidopsis thaliana At1g23080/T26J12_14 mRNA, complete cds.720008616 (4)gb:AF515434_18074553e-36Populus tremula x Populus tremuloides PIN1-like auxin transport protein (pin3) m

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021K08+ AAACGACACAATCGACGC
                      ____________________________________________________________
consensus AAACGACACAATCGACGC
 
. : . : . : . : . : . :
JMFS119A10+ CTGTTCCATAATCAGCATCTTGGCGCCGCGATACTCGAACAGAAA
JMFS095C12+ TGTTCCATAATCAGCATCTTGGCGCCGCGATACTCGAACAGAAA
JMFS016C09+ TTCCATAATCAGCATCTTGGCGCCGCGATACTCGAACAGAAA
JMFS150G02+ ATCAGCATCTGGGCGCCGCGATACTCGAACAGAAA
JMFS011D02+ CGGGAACTGTTCCATAATCAGCATCTTGGCGCCGCGATACTCGAACAGAAA
JMFS102D06+ CCGGGAACTGTTCCATAATCAGCATCTTGGCGCCGCGATACTCGAACAGAAA
JMSF021K08+ CGCCGTCTCCGGGAACTGTTCCATAATCAGCATCTTGGCGCCGCGATACTCGAACAGAAA
                      ____________________________________________________________
consensus CGCCGTCTCCGGGAACTGTTCCATAATCAGCATCTTGGCGCCGCGATACTCGAACAGAAA
 
. : . : . : . : . : . :
JMFS119A10+ AAGCAGCAGAGTATACCAAATAATGCACTGAAGTACAACCACCTGAACCATCAGGCTGCC
JMFS095C12+ AAGCAGCAGAGTATACCAAATAATGCACTGAAGTACAACCACCTGAACCATCAGGCTGCC
JMFS016C09+ AAGCAGCAGAGTATACCAAATAATGCACTGAAGTACAACCACCTGAACCATCAGGCTGCC
JMFS150G02+ AAGCAGCAGAGTATACCAAATAATGCACTGAAGTACAACCACCTGAACCATCAGGCTGCC
JMFS011D02+ AAGCAGCAGAGTATACCAAATAATGCACTGAAGTACAACCACCTGAACCATCAGGCTGCC
JMFS102D06+ AAGCAGCAGAGTATACCAAATAATGCACTGAAGTACAACCACCTGAACCATCAGGCTGCC
JMSF021K08+ AAGCAGCAGAGTATACCAAATAATGCACTGAAGTACAACCACCTGAACCATCAGGCTGCC
                      ____________________________________________________________
consensus AAGCAGCAGAGTATACCAAATAATGCACTGAAGTACAACCACCTGAACCATCAGGCTGCC
 
. : . : . : . : . : . :
JMFS119A10+ GGAATATTCCCCGTACATGGCAATCAGCAACGGAATCCCCATCACCAGAGTGTTCGGCAA
JMFS095C12+ GGAATATTCCCCGTACATGGCAATCAGCAACGGAATCCCCATCACCAGAGTGTTCGGCAA
JMFS016C09+ GGAATATTCCCCGTACATGGCAATCAGCAACGGAATCCCCATCACCAGAGTGTTCGGCAA
JMFS150G02+ GGAATATTCCCCGTACATGGCAATCAGCAACGGAATCCCCATCACCAGAGTGTTCGGCAA
JMFS011D02+ GGAATATTCCCCGTACATGGCAATCAGCAACGGAATCCCCATCACCAGAGTGTTCGGCAA
JMFS102D06+ GGAATATTCCCCGTACATGGCAATCAGCAACGGAATCCCCATCACCAGAGTGTTCGGCAA
JMSF021K08+ GGAATATTCCCCGTACATGGCAATCAGCAACGGAATCCCCATCACCAGAGTGTTCGGCAA
                      ____________________________________________________________
consensus GGAATATTCCCCGTACATGGCAATCAGCAACGGAATCCCCATCACCAGAGTGTTCGGCAA
 
. : . : . : . : . : . :
JMFS119A10+ CGTCGAGAGGGAAAAGATGGTAATACTCCATTCCAGGCTGCCATTTTTGCTCAAATTCGC
JMFS095C12+ CGTCGAGAGGGAAAAGATGGTAATACTCCATTCCAGGCTGCCATTTTTGCTCAAATTCGC
JMFS016C09+ CGTCGAGAGGGAAAAGATGGTAATACTCCATTCCAGGCTGCCATTTTTGCTCAAATTCGC
JMFS150G02+ CGTCGAGAGGGAAAAGATGGTAATACTCCATTCCAGGCTGCCATTTTTGCTCAAATTCGC
JMFS011D02+ CGTCGAGAGGGAAAAGATGGTAATACTCCATTCCAGGCTGCCATTTTTGCTCAAATTCGC
JMFS102D06+ CGTCGAGAGGGAAAAGATGGTAATACTCCATTCCAGGCTGCCATTTTTGCTCAAATTCGC
JMFF009L24+ TTTGCTCAAATTCGC
JMSF021K08+ CGTCGAGAGGGAAAAGATGGTAATACTCCATTCCAGGCTGCCATTTTTGCTCAAATTCGC
                      ____________________________________________________________
consensus CGTCGAGAGGGAAAAGATGGTAATACTCCATTCCAGGCTGCCATTTTTGCTCAAATTCGC
 
. : . : . : . : . : . :
JMFS119A10+ CCAGAAACAGAGCACCACGAGCATGATGATCTTCTGGAGGGTATCGGCGGCGATGAACCG
JMFS095C12+ CCAGAAACAGAGCACCACGAGCATGATGATCTTCTGGAGGGTATCGGCGGCGATGAACCG
JMFS016C09+ CCAGAAACAGAGCACCACGAGCATGATGATCTTCTGGAGGGTATCGGCGGCGATGAACCG
JMFS150G02+ CCAGAAACAGAGCACCACGAGCATGATGATCTTCTGGAGGGTATCGGCGGCGATGAACCG
JMFS011D02+ CCAGAAACAGAGCACCACGAGCATGATGATCTTCTGGAGGGTATCGGCGGCGATGAACCG
JMFS102D06+ CCAGAAACAGAGCACCACGAGCATGATGATCTTCTGGAGGGTATCGGCGGCGATGAACCG
JMFF009L24+ CCAGAAACAGAGCACCACGAGCATGATGATCTTCTGGAGGGTATCGGCGGCGATGAACCG
JMSF021K08+ CCAGAAACAGAGCACCACGAGCATGATGATCTTCTGGAGGGTATCGGCGGCGATGAACCG
                      ____________________________________________________________
consensus CCAGAAACAGAGCACCACGAGCATGATGATCTTCTGGAGGGTATCGGCGGCGATGAACCG
 
. : . : . : . : . : . :
JMFS119A10+ GAGATTCATCTCGTACGGATTGTTACTGGAGATAAAGTGGAAGGACAGTAAAGGGACGGC
JMFS095C12+ GAGATTCATCTCGTACGGATTGTTACTGGAGATAAAGTGGAAGGACAGTAAAGGGACGGC
JMFS016C09+ GAGATTCATCTCGTACGGATTGTTACTGGAGATAAAGTGGAAGGACAGTAAAGGGACGGC
JMFS150G02+ GAGATTCATCTCGTACGGATTGTTACTGGAGATAAAGTGGAAGGACAGTAAAGGGACGGC
JMFS011D02+ GAGATTCATCTCGTACGGATTGTTACTGGAGATAAAGTGGAAGGACAGTAAAGGGACGGC
JMFS102D06+ GAGATTCATCTCGTACGGATTGTTACTGGAGATAAAGTGGAAGGACAGTAAAGGGACGGC
JMFF009L24+ GAGATTCATCTCGTACGGATTGTTACTGGAGATAAAGTGGAAGGACAGTAAAGGGACGGC
JMSF021K08+ GAGATTCATCTCGTACGGATTGTTACTGGAGATAAAGTGGAAGGACAGTAAAGGGACGGC
                      ____________________________________________________________
consensus GAGATTCATCTCGTACGGATTGTTACTGGAGATAAAGTGGAAGGACAGTAAAGGGACGGC
 
. : . : . : . : . : . :
JMFS119A10+ GAAAATGGCGACGAAGCGGTTGATCCCGGAGCACTGGTCGGGGGTGAAGATCTTCCACCA
JMFS095C12+ GAAAATGGCGACGAAGCGGTTGATCCCGGAGCACTGGTCGGGGGTGAAGATCTTCCACCA
JMFS016C09+ GAAAATGGCGACGAAGCGGTTGATCCCGGAGCACTGGTCGGGGGTGAAGATCTTCCACCA
JMFS150G02+ GAAAATGGCGACGAAGCGGTTGATCCCGGAGCACTGGTCGGGGGTGAAGATCTTCCACCA
JMFS011D02+ GAAAATGGCGACGAAGCGGTTGATCCCGGAGCACTGGTCGGGGGTGAAGATCTTCCACCA
JMFS102D06+ GAAAATGGCGACGAAGCGGTTGATCCCGGAGCACTGGTCGGGGGTGAAGATCTTCCACCA
JMFF009L24+ GAAAATGGCGACGAAGCGGTTGATCCCGGAGCACTGGTCGGGGGTGAAGATCTTCCACCA
JMSF017E02+ ACCA
JMSF021K08+ GAAAATGGCGACGAAGCGGTTGATCCCGGAGCACTGGTCGGGGGTGAAGATCTTCCACCA
                      ____________________________________________________________
consensus GAAAATGGCGACGAAGCGGTTGATCCCGGAGCACTGGTCGGGGGTGAAGATCTTCCACCA
 
. : . : . : . : . : . :
JMFS119A10+ CCGCACGGAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCACCGCCGTTAAGAC
JMFS095C12+ CCGCACGGAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCACCGCCGTTAAGAC
JMFS016C09+ CCGCACGGAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCACCGCCGTTAAGAC
JMFS150G02+ CCGCACGGAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCACCGCCGTTAAGAC
JMFS011D02+ CCGCACGGAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCACCGCCGTTAAGAC
JMFS102D06+ CCGCACGGAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCACCGCCGTTAAGAC
JMFF009L24+ CCGCACGGAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCNCCGCCGTTAAGAC
JMSF017E02+ CCGCACGGAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCACCGCCGTTAAGAC
JMSF015G02+ CGCACGGAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCACCGCCGTTAAGAC
JMSF005M15+ GAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCACCGCCGTTAAGAC
JMSF021K08+ CCGCACGGAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCACCGCCGTTAAGAC
                      ____________________________________________________________
consensus CCGCACGGAGCCGTAGGCCAATATCATTGCCACGTAAAGCGGGACCACCGCCGTTAAGAC
 
. : . : . : . : . : . :
JMFS119A10+ CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
JMFS095C12+ CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
JMFS016C09+ CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
JMFS150G02+ CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
JMFS011D02+ CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
JMFS102D06+ CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
JMFF009L24+ CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
JMSF017E02+ CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
JMSF015G02+ CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
JMSF005M15+ CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
JMSF021K08+ CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
                      ____________________________________________________________
consensus CACGTAAAGATCATGCCAAGTAATCATTTTTCTTGGTTTTCCGGCGAGGAAAGCTAGAAT
 
. : . : . : . : . : . :
JMFS119A10+ GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGA--CTTGA
JMFS095C12+ GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGA--CTTGA
JMFS016C09+ GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGA--CTTGA
JMFS150G02+ GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGACCCTTGA
JMFS011D02+ GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGA--CTTGA
JMFS102D06+ GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGA--CTTGA
JMFF009L24+ GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGA--CTTGA
JMSF017E02+ GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGA--CTTGA
JMSF015G02+ GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGA--CTTGA
JMSF005M15+ GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGA--CTTGA
JMSF021K08+ GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGA--CTTGA
                      ____________________________________________________________
consensus GGGAGAAAAAGAAGAAGAAGAAAGTATTTATGAAGTGTAAAGAGCTAGTGAGA--CTTGA
 
. : . : . : . : . : . :
JMFS119A10+ AATTGGAGTGGGATTGGGGAAGAGAGAGAGAGAGAG
JMFS095C12+ AATTGGAGTGGGATTGGGGAAGAGAGAGAGA
JMFS016C09+ AATTGGAGTGGGATTGGGGAAGAGAGAGAGAGA
JMFS150G02+ AATTGGAGTG
JMFS011D02+ AATTGGAGTGGGATTGGGGAAGAGAGAGAGAGAGAGA
JMFS102D06+ AATTGGAGTGGGATTGGGGAAGAGAGAGAGA
JMFF009L24+ AATTGGAGTGGGATTGGGGAAGAGAGAGAGAGAGAGAGTGAAGAAAGAGAGATT
JMSF017E02+ AATTGGAGTGGGATTGGGGAAGAGAGAGAGAGAGAGAGTGAAGAAAGAGAGATT
JMSF015G02+ AATTGGAGTGGGATTGGGGAAGAGAGAGAGAGAGAGAGTGAAGAAAGAGAGATT
JMSF005M15+ AATTGGAGTGGGATTGGGGAAGAGAGAGAGAGAGAGAGTGAAGAAAGAGAGATT
JMSF021K08+ AATTGGAGTGGGATTGGGGAAGAGAGAGAGAGAGAGAGTGAAGAAAGAGAGATTAGTTCC
                      ____________________________________________________________
consensus AATTGGAGTGGGATTGGGGAAGAGAGAGAGAGAGAGAGTGAAGAAAGAGAGATTAGTTCC