Previous Contig 005991:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011B22Sequence351005991 (2)738011613 (2)gb:AP004868_18462874e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P004
JMSF021I03Sequence690005991 (2)gb:AP005092_18476612e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ11749011613 (2)gb:AP004868_18462878e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P004

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021I03+ CTGATAACCATCTCTGCTGAGTTTCTTAAT
                      ____________________________________________________________
consensus CTGATAACCATCTCTGCTGAGTTTCTTAAT
 
. : . : . : . : . : . :
JMSF021I03+ CGCAACCACGATTCGGTCACCTTTACCATCAACTGGCTTAACCATTCCCTNGTACACACT
                      ____________________________________________________________
consensus CGCAACCACGATTCGGTCACCTTTACCATCAACTGGCTTAACCATTCCCTNGTACACACT
 
. : . : . : . : . : . :
JMSF021I03+ CCCAAAACCGCCCTCTCCAACCTTAAGTAACCTGCAGAAATTATGGTTGCTTGTCTAAGT
                      ____________________________________________________________
consensus CCCAAAACCGCCCTCTCCAACCTTAAGTAACCTGCAGAAATTATGGTTGCTTGTCTAAGT
 
. : . : . : . : . : . :
JMSF011B22+ TAGGCTTCAGAGAAGCTA
JMSF021I03+ TCATTGAAGGAAAACTCTCTCAAGTTTTGAGCTTTCCCCTCGTAGGCTTCAGAGAAGCTA
                      ____________________________________________________________
consensus TCATTGAAGGAAAACTCTCTCAAGTTTTGAGCTTTCCCCTCGTAGGCTTCAGAGAAGCTA
 
. : . : . : . : . : . :
JMSF011B22+ CGGGGAGACGAGGCTGAACATGAAGAGCGCGTGGCCCTTTCAGCCGCCCCTGAAATATCT
JMSF021I03+ CGGGGAGACGAGGCTGAACATGAAGAGCGCGTGGCCCTTTCAGCCGCCCCTGAAATATCT
                      ____________________________________________________________
consensus CGGGGAGACGAGGCTGAACATGAAGAGCGCGTGGCCCTTTCAGCCGCCCCTGAAATATCT
 
. : . : . : . : . : . :
JMSF011B22+ GATGATTTGCTCTGCTCCTTCAACACTGGTGCTGATTTTTGTGCCTTTCCTTTGTTTCTA
JMSF021I03+ GATGATTTGCTCTGCTCCTTCAACACTGGTGCTGATTTTTGTGCCTTTCCTTTGTTTCTA
                      ____________________________________________________________
consensus GATGATTTGCTCTGCTCCTTCAACACTGGTGCTGATTTTTGTGCCTTTCCTTTGTTTCTA
 
. : . : . : . : . : . :
JMSF011B22+ TCCTTGAAGTATAGCAAACAATTCATCTTCTCTCTCCCAATTCAATGTTCAATAGCAGCT
JMSF021I03+ TCCTTGAAGTATAGCAAACAATTCATCTTCTCTCTCCCAATTCAATGTTCAATAGCAGCT
                      ____________________________________________________________
consensus TCCTTGAAGTATAGCAAACAATTCATCTTCTCTCTCCCAATTCAATGTTCAATAGCAGCT
 
. : . : . : . : . : . :
JMSF011B22+ CAGCTCCCTCACAATAAACTGATTTTGTTTCTATCCTTGAAGTATAGCAAACAATTCATC
JMSF021I03+ CAGCTCCCTCACAATAAACTGATTTTGTTTCTATCCTTGAAGTATAGCAAACAATTCATC
                      ____________________________________________________________
consensus CAGCTCCCTCACAATAAACTGATTTTGTTTCTATCCTTGAAGTATAGCAAACAATTCATC
 
. : . : . : . : . : . :
JMSF011B22+ TTCTTCCCCCTTCCTCTCTCTCAATTCAATGTTCAATAACAGCTCCCTCACAATAAACTG
JMSF021I03+ TTCTTCCCCCTTCCTCTCTCTCAATTCAATGTTCAATAACAGCTCCCTCACAATAAACTG
                      ____________________________________________________________
consensus TTCTTCCCCCTTCCTCTCTCTCAATTCAATGTTCAATAACAGCTCCCTCACAATAAACTG
 
. : . : . : . : . : . :
JMSF011B22+ ATTTTGTTCAACCGCTTGGACTCCTGGGGCTC
JMSF021I03+ ATTTTGTTCAACCGCTTGGACTCCTGGGGCTCAGGAAAGTGTCAACTTTCAGAAGTTAAA
                      ____________________________________________________________
consensus ATTTTGTTCAACCGCTTGGACTCCTGGGGCTCAGGAAAGTGTCAACTTTCAGAAGTTAAA
 
. : . : . : . : . : . :
JMSF021I03+ AGATTAAATAAACATAAAGGAAATATATTAAAGATCTGGGAAGGTTTGTGAATCTTCAAC
                      ____________________________________________________________
consensus AGATTAAATAAACATAAAGGAAATATATTAAAGATCTGGGAAGGTTTGTGAATCTTCAAC
 
. : . : . : . : . : . :
JMSF021I03+ TGTAGTTTGACTGCTTGGGGGTTGGCCCCTTTCTCTCCTGTCTCACTCAAATCTCAATCC
                      ____________________________________________________________
consensus TGTAGTTTGACTGCTTGGGGGTTGGCCCCTTTCTCTCCTGTCTCACTCAAATCTCAATCC