Previous Contig 005989:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021H23Sequence679005989 (3)gb:BT015054_16420242e-23Arabidopsis thaliana At2g35100 gene, complete cds.>gb:BT015854_1642472 Arabidops
JMSF022H23Sequence669005989 (3)gb:BT015054_16420246e-23Arabidopsis thaliana At2g35100 gene, complete cds.>gb:BT015854_1642472 Arabidops
JMSF048L12Sequence643005989 (3)gb:BT015054_16420244e-24Arabidopsis thaliana At2g35100 gene, complete cds.>gb:BT015854_1642472 Arabidops808024321gb:BT015054_16420241e-83Arabidopsis thaliana At2g35100 gene, complete cds.>gb:BT015854_1642472 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048L12+ TCTCATCACTATACACAGGCCGATCCCCTGAGGGCGGCCGATTCACAGGATT
JMSF022H23+ TT
JMSF021H23+ GCGGCCGATTCACAGGATT
                      ____________________________________________________________
consensus TCTCATCACTATACACAGGCCGATCCCCTGAGGGCGGCCGATTCACAGGATT
 
. : . : . : . : . : . :
JMSF048L12+ CACAACAAGGCTCAAAGACGAGAAAAAAGGCACGTAGAAGAGGTCAGCCTGATCGGGGTC
JMSF022H23+ CACAACAAGGCTCAAAGACGAGAAAAAAGGCACGTAGAAGAGGTCAGCCTGATCGGGGTC
JMSF021H23+ CACAACAAGGCTCAAAGACGAGAAAAAAGGCACGTAGAAGAGGTCAGCCTGATCGGGGTC
                      ____________________________________________________________
consensus CACAACAAGGCTCAAAGACGAGAAAAAAGGCACGTAGAAGAGGTCAGCCTGATCGGGGTC
 
. : . : . : . : . : . :
JMSF048L12+ AGACACTGGAAGGACGGCCGACCCGGCCCGGCCACGATTGGGTAAGCGGAGGCTGGTGAA
JMSF022H23+ AGACACTGGAAGGACGGCCGACCCGGCCCGGCCACGATTGGGTAAGCGGAGGCTGGTGAA
JMSF021H23+ AGACACTGGAAGGACGGCCGACCCGGCCCGGCCACGATTGGGTAAGCGGAGGCTGGTGAA
                      ____________________________________________________________
consensus AGACACTGGAAGGACGGCCGACCCGGCCCGGCCACGATTGGGTAAGCGGAGGCTGGTGAA
 
. : . : . : . : . : . :
JMSF048L12+ GAGGTGCCATTCGGCGGCATGCTGAGTGCCGGGGTACTTAAGCAATGCGTCGTCCTCTAC
JMSF022H23+ GAGGTGCCATTCGGCGGCATGCTGAGTGCCGGGGTACTTAAGCAATGCGTCGTCCTCTAC
JMSF021H23+ GAGGTGCCATTCGGCGGCATGCTGAGTGCCGGGGTACTTAAGCAATGCGTCGTCCTCTAC
                      ____________________________________________________________
consensus GAGGTGCCATTCGGCGGCATGCTGAGTGCCGGGGTACTTAAGCAATGCGTCGTCCTCTAC
 
. : . : . : . : . : . :
JMSF048L12+ CCTCTCCCCTCCACGGGCCAAATTGTAGCTCTCGATCACCCCGTAGGTGAAATTCCTGGG
JMSF022H23+ CCTCTCCCCTCCACGGGCCAAATTGTAGCTCTCGATCACCCCGTAGGTGAAATTCCTGGG
JMSF021H23+ CCTCTCCCCTCCACGGGCCAAATTGTAGCTCTCGATCACCCCGTAGGTGAAATTCCTGGG
                      ____________________________________________________________
consensus CCTCTCCCCTCCACGGGCCAAATTGTAGCTCTCGATCACCCCGTAGGTGAAATTCCTGGG
 
. : . : . : . : . : . :
JMSF048L12+ CAGATCGTACATATAAACCTTCACAGGCACTGGATGTTTCGCCCCGAAATACTCTGCGTT
JMSF022H23+ CAGATCGTACATATAAACCTTCACAGGCACTGGATGTTTCGCCCCGAAATACTCTGCGTT
JMSF021H23+ CAGATCGTACATATAAACCTTCACAGGCACTGGATGTTTCGCCCCGAAATACTCTGCGTT
                      ____________________________________________________________
consensus CAGATCGTACATATAAACCTTCACAGGCACTGGATGTTTCGCCCCGAAATACTCTGCGTT
 
. : . : . : . : . : . :
JMSF048L12+ GCTTCCGAAATCAGCAAAGCCAATGGCATTGTTGATGGACAGAGGAGTAGAGAAGATGAA
JMSF022H23+ GCTTCCGAAATCAGCAAAGCCAATGGCATTGTTGATGGACAGAGGAGTAGAGAAGATGAA
JMSF021H23+ GCTTCCGAAATCAGCAAAGCCAATGGCATTGTTGATGGACAGAGGAGTAGAGAAGATGAA
                      ____________________________________________________________
consensus GCTTCCGAAATCAGCAAAGCCAATGGCATTGTTGATGGACAGAGGAGTAGAGAAGATGAA
 
. : . : . : . : . : . :
JMSF048L12+ GGAATTGAGGAAGGCGTAGAGAGCTAAAAGTGAGATGAGAACAGCGAGGGTTAGGGTTGG
JMSF022H23+ GGAATTGAGGAAGGCGTAGAGAGCTAAAAGGGAGATGAGAACAGCGAGGGTTAGGGTTGG
JMSF021H23+ GGAATTGAGGAAGGCGTAGAGAGCTAAAAGGGAGATGAGAACAGCGAGGGTTAGGGTTGG
                      ____________________________________________________________
consensus GGAATTGAGGAAGGCGTAGAGAGCTAAAAGGGAGATGAGAACAGCGAGGGTTAGGGTTGG
 
. : . : . : . : . : . :
JMSF048L12+ TTTGAGGATTGATCTCTTCGGCATTTTGGTGCTGGGAGTCATTGAGATTTTGAGGGAATC
JMSF022H23+ TTTGAGGATTGATCTCTTCGGCATTTTGGTGCTGGGAGTCATTGAGATTTTGAGTGAATC
JMSF021H23+ TTTGAGGATTGATCTCTTCGGCATTTTGGTGCTGGGAGTCATTGAGATTTTGAGTGAATC
                      ____________________________________________________________
consensus TTTGAGGATTGATCTCTTCGGCATTTTGGTGCTGGGAGTCATTGAGATTTTGAGTGAATC
 
. : . : . : . : . : . :
JMSF048L12+ ATAGTTTGGAAACCCTGGGGAAGTTAGTTGCGGCGGCGATCGGAATTTTGCGCGATTTGA
JMSF022H23+ ATAGTTTGGAAACCCTGGGGAAGTTAGTTGCGGCGGCGATCGGAATTTTGCGCGATTTGA
JMSF021H23+ ATAGTTTGGAAACCCTGGGGAAGTTAGTTGCGGCGGCGATCGGAATTTTGCGCGATTTGA
                      ____________________________________________________________
consensus ATAGTTTGGAAACCCTGGGGAAGTTAGTTGCGGCGGCGATCGGAATTTTGCGCGATTTGA
 
. : . : . : . : . : . :
JMSF048L12+ ATTCATTGAGTGATCGGAGACATCTGCGAGCGGTGGGAAAACTCAAAAC
JMSF022H23+ ATTCATTGAGTGATCGGAGACATCTGCGAGCGGTGGGAAAACTCAAAACTGGACGTCTGG
JMSF021H23+ ATTCATTGAGTGATCGGAGACATCTGCGAGCGGTGGGAAAACTCAAAACTGGACGTCTGG
                      ____________________________________________________________
consensus ATTCATTGAGTGATCGGAGACATCTGCGAGCGGTGGGAAAACTCAAAACTGGACGTCTGG
 
. : . : . : . : . : . :
JMSF022H23+ GCCCGAAGACATTCACTTCTATTGTACTATCGTTTTGTATTTTTCATAGTTAGTAGTGCC
JMSF021H23+ GCCCGAAGACATTCACTTCTATTGTACTATCGTTTTGTATTTTTCATAGTTAGTAGTGCC
                      ____________________________________________________________
consensus GCCCGAAGACATTCACTTCTATTGTACTATCGTTTTGTATTTTTCATAGTTAGTAGTGCC