Previous Contig 005987:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036A10Sequence495005987 (7)gb:AY093790_15754422e-13Arabidopsis thaliana At2g20670/F23N11.1 mRNA, complete cds.>gb:AF411793_1797258 646005987 (7)pir|T05358|T053588e-42hypothetical protein F8B4.180 - Arabidopsis thaliana>gb:ATCHRIV77_1547168 Arabid
JMFF050E09Sequence634005987 (7)pir|H84591|H845912e-27hypothetical protein At2g20670 [imported] - Arabidopsis thaliana>gb:AC006234_153470005987 (7)pir|T05358|T053584e-20hypothetical protein F8B4.180 - Arabidopsis thaliana>gb:ATCHRIV77_1547168 Arabid
JMFN013D04Sequence613005987 (7)pir|H84591|H845915e-27hypothetical protein At2g20670 [imported] - Arabidopsis thaliana>gb:AC006234_153
JMFN043N19Sequence612005987 (7)pir|H84591|H845915e-27hypothetical protein At2g20670 [imported] - Arabidopsis thaliana>gb:AC006234_153
JMSF021H14Sequence655005987 (7)pir|H84591|H845913e-30hypothetical protein At2g20670 [imported] - Arabidopsis thaliana>gb:AC006234_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF050E09- CACACAAAGGATCAATTTCTACATTTCCGTGAAGTTGAAGAACTCAATCTTCAAGTG
rJMFF036A10- TTTCCGTGAAGTTGAAGAACTCAATCTTCAAGTG
                      ____________________________________________________________
consensus CACACAAAGGATCAATTTCTACATTTCCGTGAAGTTGAAGAACTCAATCTTCAAGTG
 
. : . : . : . : . : . :
rJMFF050E09- ATAGGATCCACTAAAGGTAGGAAGGAGTGGATCATAAATTTACTTATAAACAAATATATA
rJMFF036A10- ATAGGATCCACTAGAGGTAGGAAGGAGTGGATCATAAATTTACTTATAAACAAATATATA
                      ____________________________________________________________
consensus ATAGGATCCACTAGAGGTAGGAAGGAGTGGATCATAAATTTACTTATAAACAAATATATA
 
. : . : . : . : . : . :
rJMFF050E09- TGTAGCTAGCTATAACATAATAATCAATATAATTCATCCATGTTCACACGACCGCCACCG
rJMFF036A10- TGTAGCTAGCTATAACATAATAATCAATATAATTCATCCATGTTCACACGACCGCCACCG
                      ____________________________________________________________
consensus TGTAGCTAGCTATAACATAATAATCAATATAATTCATCCATGTTCACACGACCGCCACCG
 
. : . : . : . : . : . :
rJMFF050E09- CCGTGCGGTGCAAAGTGGGCAAATTGTCGAGCAAGTCAACGGTGAGCATCGACGCCGTAG
rJMFF036A10- CCGTGCGGTGCAAAGTGGGCAAATTGTCGAGCAAGTCAACGGTGAGCATCGACGCCGTAG
                      ____________________________________________________________
consensus CCGTGCGGTGCAAAGTGGGCAAATTGTCGAGCAAGTCAACGGTGAGCATCGACGCCGTAG
 
. : . : . : . : . : . :
rJMFF050E09- GCCGGGGTGCTCGGCCACTGTATCCGGCGGACTCCGGCGGCGGCGCGGTGATGGTGCGGT
rJMFF036A10- GCCGGGGTGCTCGGCCACTGTATCCGGCGGACTCCGGCGGCGGCGCGGTGATGGTGCGGT
                      ____________________________________________________________
consensus GCCGGGGTGCTCGGCCACTGTATCCGGCGGACTCCGGCGGCGGCGCGGTGATGGTGCGGT
 
. : . : . : . : . : . :
rJMFF050E09- GGCACGTTCTGAGCCACTTGGCTTGCATGTACTTTTGCTTTCTCCAAGGACCCAGGGGCA
rJMFF036A10- GGCACGTTCTGAGCCACTTGGCTTGCATGTACTTTTGCTTTCTCCAAGGACCCAGGTGCA
                      ____________________________________________________________
consensus GGCACGTTCTGAGCCACTTGGCTTGCATGTACTTTTGCTTTCTCCAAGGACCCAGGTGCA
 
. : . : . : . : . : . :
rJMFF050E09- TTTTCCTCTCCTTCATGCACCTCTTCGCCGCCGTGCACATGATCTTGATCACCGACAATA
rJMFF036A10- TTTTCCTCTCCTTCATGCACCTCTTCGCCGCCGTGCACATGATCTTGATCACCGACAATA
                      ____________________________________________________________
consensus TTTTCCTCTCCTTCATGCACCTCTTCGCCGCCGTGCACATGATCTTGATCACCGACAATA
 
. : . : . : . : . : . :
rJMFF050E09- GCCTCTCTATTTTTCCGACGAAAACTTCCGGCAGGCTCGTGACAAGTCGCCCG
rJMFF036A10- GCCTCTCTATTTTTCCGACGAAAACTTCCGGCAGGCTCGTGACAAGTCGCCCGTACTCTT
                      ____________________________________________________________
consensus GCCTCTCTATTTTTCCGACGAAAACTTCCGGCAGGCTCGTGACAAGTCGCCCGTACTCTT
 
. : . : . : . : . : . :
rJMFF036A10- CATTTGATCTCGCCATCTCAAACTCCCCTCGAAAATTTAGTTCGATTATGATCCTCACTT
JMFF050E09+ GAAAATNTAGTTCGATTATGATCCTCACTT
JMFN043N19+ AAAATTTAGTTCGATTATGATCCTCACTT
JMFN013D04+ GAAAATTTAGTTCGATTATGATCCTCACTT
JMSF021H14+ GATCTCGCCATCTCAAACTCCCCTCGAAAATTTAGTTCGATTATGATCCTCACTT
                      ____________________________________________________________
consensus CATTTGATCTCGCCATCTCAAACTCCCCTCGAAAATTTAGTTCGATTATGATCCTCACTT
 
. : . : . : . : . : . :
rJMFF036A10- CTCCCCTTTTGGGATTATTTGAATTCTCCATCACGTCTACAAATGTGTGTTCACCTGATG
JMFF050E09+ CTCCCCTTTTGGGATTATTTGAATTCTCCATCACGTCTACAAATGTGTGTTCACCTGATG
JMFN043N19+ CTCCCCTTTTGGGATTATTTGAATTCTCCATCACGTCTACAAATGTGTGTTCACCTGATG
JMFN013D04+ CTCCCCTTTTGGGATTATTTGAATTCTCCATCACGTCTACAAATGTGTGTTCACCTGATG
JMSF021H14+ CTCCCCTTTTGGGATTATTTGAATTCTCCATCACGTCTACAAATGTGTGTTCACCTGATG
                      ____________________________________________________________
consensus CTCCCCTTTTGGGATTATTTGAATTCTCCATCACGTCTACAAATGTGTGTTCACCTGATG
 
. : . : . : . : . : . :
rJMFF036A10- GGATATCTGATAGGTTCTTCCACTTAGACTTGCAAATTGCTGAGTTGAAACCAGCATTTT
JMFF050E09+ GGATATCTGATAGGTTCTTCCACTTAGACTTGCAAATTGCTGAGTTGAAACCAGCATTTT
JMFN043N19+ GGATATCTGATAGGTTCTTCCACTTAGACTTGCAAATTGCTGAGTTGAAACCAGCATTTT
JMFN013D04+ GGATATCTGATAGGTTCTTCCACTTAGACTTGCAAATTGCTGAGTTGAAACCAGCATTTT
JMFF036A10+ TTGAAACCAGCATTTT
JMSF021H14+ GGATATCTGATAGGTTCTTCCACTTAGACTTGCAAATTGCTGAGTTGAAACCAGCATTTT
                      ____________________________________________________________
consensus GGATATCTGATAGGTTCTTCCACTTAGACTTGCAAATTGCTGAGTTGAAACCAGCATTTT
 
. : . : . : . : . : . :
rJMFF036A10- GTAG
JMFF050E09+ GTAGACGCCGGAAAACCTCATTCATTCGGCAGCTCCGGCAGCCGCCGTCCACCGGTTTCT
JMFN043N19+ GTAGACGCCGGAAAACCTCATTCATTCGGCAGCTCCGGCAGCCGCCGTCCACCGGTTTCT
JMFN013D04+ GTAGACGCCGGAAAACCTCATTCATTCGGCAGCTCCGGCAGCCGCCGTCCACCGGTTTCT
JMFF036A10+ GTAGACGCCGGAAAACCTCATTCATTCGGCAGCTCCGGCAGCCGCCGTCCACCGGTTTCT
JMSF021H14+ GTAGACGCCGGAAAACCTCATTCATTCGGCAGCTCCGGCAGCCGCCGTCCACCGGTTTCT
                      ____________________________________________________________
consensus GTAGACGCCGGAAAACCTCATTCATTCGGCAGCTCCGGCAGCCGCCGTCCACCGGTTTCT
 
. : . : . : . : . : . :
JMFF050E09+ GACAAGCACACATGTTTCCGGCTTGCTTTGCTTCTTTTAATGTTTCTTTAGTAATACTCC
JMFN043N19+ GACAAGCACACATGTTTCCGGCTTGCTTTGCTTCTTTTAATGTTTCTTTAGTAATACTCC
JMFN013D04+ GACAAGCACACATGTTTCCGGCTTGCTTTGCTTCTTTTAATGTTTCTTTAGTAATACTCC
JMFF036A10+ GACAAGCACACATGTTTCCGGCTTGCTTTGCTTCTTTTAATGTTTCTTTAGTAATACTCC
JMSF021H14+ GACAAGCACACATGTTTCCGGCTTGCTTTGCTTCTTTTAATGTTTCTTTAGTAATACTCC
                      ____________________________________________________________
consensus GACAAGCACACATGTTTCCGGCTTGCTTTGCTTCTTTTAATGTTTCTTTAGTAATACTCC
 
. : . : . : . : . : . :
JMFF050E09+ GGATTCTTGATTCTGCCGAGGTGGTCCTGCATAACGTAGCATGTAAGAGATTGTATTGAT
JMFN043N19+ GGATTCTTGATTCTGCCGAGGTGGTCCTGCATAACGTAGCATGTAAGAGATTGTATTGAT
JMFN013D04+ GGATTCTTGATTCTGCCGAGGTGGTCCTGCATAACGTAGCATGTAAGAGATTGTATTGAT
JMFF036A10+ GGATTCTTGATTCTGCCGAGGTGGTCCTGCATAACGTAGCATGTAAGAGATTGTATTGAT
JMSF021H14+ GGATTCTTGATTCTGCCGAGGTGGTCCTGCATAACGTAGCATGTAAGAGATTGTATTGAT
                      ____________________________________________________________
consensus GGATTCTTGATTCTGCCGAGGTGGTCCTGCATAACGTAGCATGTAAGAGATTGTATTGAT
 
. : . : . : . : . : . :
JMFF050E09+ TTTCCCAGAAATCACTCTCTTGAACGATTTCTTTTTCTTCGTTTTCATCATCTTCATCAC
JMFN043N19+ TTTCCCAGAAATCACTCTCTTGAACGATTTCTTTTTCTTCGTTTTCATCATCTTCATCAC
JMFN013D04+ TTTCCCAGAAATCACTCTCTTGAACGATTTCTTTTTCTTCGTTTTCATCATCTTCATCAC
JMFF036A10+ TTTCCCAGAAATCACTCTCTTGAACGATTTCTTTTTCTTCGTTTTCATCATCTTCATCAC
JMSF021H14+ TTTCCCAGAAATCACTCTCTTGAACGATTTCTTTTTCTTCGTTTTCATCATCTTCATCAC
                      ____________________________________________________________
consensus TTTCCCAGAAATCACTCTCTTGAACGATTTCTTTTTCTTCGTTTTCATCATCTTCATCAC
 
. : . : . : . : . : . :
JMFF050E09+ GTACATTATCGCAGATGGAGTACTGGGACGACGACGACGACCGTTCACCTTCATCGTCGA
JMFN043N19+ GTACATTATCGCAGATGGAGTACTGGGACGACGACGACGACCGTTCACCTTCATCGTCGA
JMFN013D04+ GTACATTATCGCAGATGGAGTACTGGGACGACGACGACGACCGTTCACCTTCATCGTCGA
JMFF036A10+ GTACATTATCGCAGATGGAGTACTGGGACGACGACGACGACCGTTCACCTTCATCGTCGA
JMSF021H14+ GTACATTATCGCAGATGGAGTACTGGGACGACGACGACGACCGTTCACCTTCATCGTCGA
                      ____________________________________________________________
consensus GTACATTATCGCAGATGGAGTACTGGGACGACGACGACGACCGTTCACCTTCATCGTCGA
 
. : . : . : . : . : . :
JMFF050E09+ GAAACTCGAAGACGGTATCGGACAAATTAATGGCCGGGTCGCCGGAAAAGTCGATGTCCG
JMFN043N19+ GAAACTCGAAGACGGTATCGGACAAATTAATGGCCGGGTCGCCGGAAAAGTCGATGTCCG
JMFN013D04+ GAAACTCGAAGACGGTATCGGACAAATTAATGGCCGGGTCGCCGGAAAAGTCGATGTCCG
JMFF036A10+ GAAACTCGAAGACGGTATCGGACAAATTAATGGCCGGGTCGCCGGAAAAGTCGATGTCCG
JMSF021H14+ GAAACTCGAAGACGGTATCGGACAAATTAATGGCCGGGTCGCCGGAAAAGTCGATGTCCG
                      ____________________________________________________________
consensus GAAACTCGAAGACGGTATCGGACAAATTAATGGCCGGGTCGCCGGAAAAGTCGATGTCCG
 
. : . : . : . : . : . :
JMFF050E09+ TTTTGTCACACCTCAAAATCCGATGATTCATCGGAATTTTAGCCACTTTTCCGACCATGG
JMFN043N19+ TTTTGTCACACCTCAAAATCCGATGATTCATCGGAATTTTAGCCACTTTTCCGACCATGG
JMFN013D04+ TTTTGTCACACCTCAAAATCCGATGATTCATCGGAATTTTAGCCACTTTTCCGACCATGG
JMFF036A10+ TTTTGTCACACCTCAAAATCCGATGATTCATCGGAATTTTAGCCACTTTTCCGACCATGG
JMSF021H14+ TTTTGTCACACCTCAAAATCCGATGATTCATCGGAATTTTAGCCACTTTTCCGACCATGG
                      ____________________________________________________________
consensus TTTTGTCACACCTCAAAATCCGATGATTCATCGGAATTTTAGCCACTTTTCCGACCATGG
 
. : . : . : . : . : . :
JMFF050E09+ CCGAATGTATTATTTAATGTTGTCGACTTAGGTCTATAACAAGCTAGGTTTGCGTTTT
JMFN043N19+ CCGAATGTATTATTTAATGTTGTCGACTTAGGTCTATAACAAG
JMFN013D04+ CCGAATGTATTATTTAATGTTGTCGACTTAGGTCTATAACAAG
JMFF036A10+ CCGAATGTATTATTTAATGTTGTCGACTTAGGTCTATAACAAGCTAGGTTTGCGTTTT
JMSF021H14+ CCGAATGTATTATTTAATGTTGTCGACTTAGGTCTATAACAAGCTAGGTTTGCGTTTTCC
                      ____________________________________________________________
consensus CCGAATGTATTATTTAATGTTGTCGACTTAGGTCTATAACAAGCTAGGTTTGCGTTTTCC