Previous Contig 005985:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023A21Sequence415005985 (8)gb:AY086572_15716191e-42Arabidopsis thaliana clone 258748 mRNA, complete sequence.
JMFF024K07Sequence456005985 (8)gb:AY086572_15716191e-49Arabidopsis thaliana clone 258748 mRNA, complete sequence.737005985 (8)gb:AB017063_1513344e-100Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K3K7.>gb:AB120415_1527
JMFF048G20Sequence252005985 (8)gb:AY086572_15716196e-06Arabidopsis thaliana clone 258748 mRNA, complete sequence.292005985 (8)gb:AY086572_15716193e-18Arabidopsis thaliana clone 258748 mRNA, complete sequence.
JMFN013G07Sequence627005985 (8)gb:AB017063_15133441e-72Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K3K7.>gb:AB120415_1527
JMSF021H04Sequence690005985 (8)gb:AB017063_15133445e-80Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K3K7.>gb:AB120415_1527747005985 (8)gb:AB017063_1513344e-104Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K3K7.>gb:AB120415_1527

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048G20- GCGTAAATCAACGGAA
                      ____________________________________________________________
consensus GCGTAAATCAACGGAA
 
. : . : . : . : . : . :
rJMFF048G20- AATATATATTGATAGACTCGATATGGGAGTTTGAAATTTACATTACAATACTACAGAACA
rJMFF024K07- TTGATAGACTCGATATGGGAGTTTGAAATTTACATTACAATACTACAGAACA
rJMSF021H04- GGGAGTTTGAAATTTACATTACAATACTACAGAACA
                      ____________________________________________________________
consensus AATATATATTGATAGACTCGATATGGGAGTTTGAAATTTACATTACAATACTACAGAACA
 
. : . : . : . : . : . :
rJMFF048G20- AAGTATCAATCTTGAATAACAAATGAACCCTCTATTCTTTTCTCTATGGATGGGGAAGAC
rJMFF024K07- AAGTATCAATCTTGAATAACAAATGAACCCTCTATTCTTTTCTCTATGGATGGGGAAGAC
rJMSF021H04- AAGTATCAATCTTGAATAACAAATGAACCCTCTATTCTTTTCTCTATGGATGGGGAAGAC
                      ____________________________________________________________
consensus AAGTATCAATCTTGAATAACAAATGAACCCTCTATTCTTTTCTCTATGGATGGGGAAGAC
 
. : . : . : . : . : . :
rJMFF048G20- AACATCAAAGCGGAAAGGTCATCAAAACTAGAAGCTGGTGCAGGTTTGAACTCATATGGA
rJMFF024K07- AACATCAAAGCGGAAAGGTCATCAAAACTAGAAGCTGGTGCAGGTTTGAACTCATATGGA
rJMSF021H04- AACATCAAAGCGGAAAGGTCATCAAAACTAGAAGCTGGTGCAGGTTTGAACTCATATGGA
                      ____________________________________________________________
consensus AACATCAAAGCGGAAAGGTCATCAAAACTAGAAGCTGGTGCAGGTTTGAACTCATATGGA
 
. : . : . : . : . : . :
rJMFF048G20- CCTCCCTTTACACCCCAGACCTGATTTCCACTCTCATCGTAGCCTCTATCCCAGGAATGT
rJMFF024K07- CCTCCCTTTACACCCCAGACCTGATTTCCACTCTCATCGTAGCCTCTATCCCAGGAATGT
rJMSF021H04- CCTCCCTTTACACCCCAGACCTGATTTCCACTCTCATCGTAGCCTCTATCCCAGGAATGT
                      ____________________________________________________________
consensus CCTCCCTTTACACCCCAGACCTGATTTCCACTCTCATCGTAGCCTCTATCCCAGGAATGT
 
. : . : . : . : . : . :
rJMFF048G20- ATCTCATTATTCTTCACCACTGCAAGTTCTGACGTA
rJMFF024K07- ATCTCATTATTCTTCAGCACTGCAAGTTCTGACGTACAATATGATGCACCGTTCCATGTA
rJMSF021H04- ATCTCATTATTCTTCAGCACTGCAAGTTCTGACGTACAATATGATGCACCGTTCCATGTA
                      ____________________________________________________________
consensus ATCTCATTATTCTTCAGCACTGCAAGTTCTGACGTACAATATGATGCACCGTTCCATGTA
 
. : . : . : . : . : . :
rJMFF024K07- TTAGGAAATCCATCTGCAGGTGTAGATCCTTCATATAAGCATCGCTTCCCACGCTCACAG
rJMSF021H04- TTAGGAAATCCATCTGCAGGTGTAGATCCTTCATATAAGCATCGCTTCCCACGCTCACAG
JMSF021H04+ TCATATAAGCATCGCTTCCCACGCTCACAG
                      ____________________________________________________________
consensus TTAGGAAATCCATCTGCAGGTGTAGATCCTTCATATAAGCATCGCTTCCCACGCTCACAG
 
. : . : . : . : . : . :
rJMFF024K07- CGTTTCAGATGAATGGTAGTCAAATGTTCAGCAATATCCCCAATAACTTCTTCAGGTTGT
rJMSF021H04- CGTTTCAGATGAATGGTAGTCAAATGTTCAGCAATATCCCCAATAACTTCTTCAGGTTGT
JMFN013G07+ ATGGTAGTCAAATGTTCAGCAATATCCCCAATAACTTCTTCAGGTTGT
JMSF021H04+ CGTTTCAGATGAATGGTAGTCAAATGTTCAGCAATATCCCCAATAACTTCTTCAGGTTGT
                      ____________________________________________________________
consensus CGTTTCAGATGAATGGTAGTCAAATGTTCAGCAATATCCCCAATAACTTCTTCAGGTTGT
 
. : . : . : . : . : . :
rJMFF024K07- GGGCGCTGGTCCTTAGGCCGATCACAGAAGTTCTTGTACTCCTCTGCATCTCTGAGAGCA
rJMSF021H04- GGGCGCTGGTCCTTAGGCCGATCACAGAAGTTCTTGTACTCCTCTGCATCTCTGAGAGCA
JMFN013G07+ GGGCGCTGGTCCTTAGGCCGATCACAGAAGTTCTTGTACTCCTCTGCATCTCTGAGAGCA
JMSF021H04+ GGGCGCTGGTCCTTAGGCCGATCACAGAAGTTCTTGTACTCCTCTGCATCTCTGAGAGCA
                      ____________________________________________________________
consensus GGGCGCTGGTCCTTAGGCCGATCACAGAAGTTCTTGTACTCCTCTGCATCTCTGAGAGCA
 
. : . : . : . : . : . :
rJMFF024K07- TATGTGCTGACCTCAACATCACATCTCATCTCCTTTGGACAAGGCTTGACAATGCAAAAT
rJMSF021H04- TATGTGCTGACCTCAACATCACATCTCATCTCCTTTGGACAAGGCTTGACAATGCAAAAT
JMFF023A21+ CAATGCAAAAT
JMFF024K07+ ACATCACATCTCATCTCCTTTGGACAAGGCTTGACAATGCAAAAT
JMFN013G07+ TATGTGCTGACCTCAACATCACATCTCATCTCCTTTGGACAAGGCTTGACAATGCAAAAT
JMSF021H04+ TATGTGCTGACCTCAACATCACATCTCATCTCCTTTGGACAAGGCTTGACAATGCAAAAT
                      ____________________________________________________________
consensus TATGTGCTGACCTCAACATCACATCTCATCTCCTTTGGACAAGGCTTGACAATGCAAAAT
 
. : . : . : . : . : . :
rJMFF024K07- CTCTGCCGAAAAGGCTTATGAGGTGTCCTCCAGAATGCCTGCTCAAAATATAAGACCTTC
rJMSF021H04- CTCTGCCGAAAAGGCTTATGAGGTGTCCTCCAGAATGCCTGCTCAAAATATAAGACCTTC
JMFF023A21+ CTCTGCCGAAAAGGCTTATGAGGTGTCCTCCAGAATGCCTGCTCAAAATATAAGACCTTC
JMFF024K07+ CTCTGCCGAAAAGGCTTATGAGGTGTCCTCCAGAATGCCTGCTCAAAATATAAGACCTTC
JMFN013G07+ CTCTGCCGAAAAGGCTTATGAGGTGTCCTCCAGAATGCCTGCTCAAAATATAAGACCTTC
JMSF021H04+ CTCTGCCGAAAAGGCTTATGAGGTGTCCTCCAGAATGCCTGCTCAAAATATAAGACCTTC
                      ____________________________________________________________
consensus CTCTGCCGAAAAGGCTTATGAGGTGTCCTCCAGAATGCCTGCTCAAAATATAAGACCTTC
 
. : . : . : . : . : . :
rJMFF024K07- GAGCCATCTACCATGTCAGCAGCTGGGCATGAAAGCCATCTCAAATTGAAGTAACTATCA
rJMSF021H04- GAGCCATCTACCATGTCAGCAGCTGGGCATGAAAGCCATCTCAAATTGAAGTAACTATCA
JMFF023A21+ GAGCCATCTACCATGTCAGCAGCTGGGCATGAAAGCCATCTCAAATTGAAGTAACTATCA
JMFF024K07+ GAGCCATCTACCATGTCAGCAGCTGGGCATGAAAGCCATCTCAAATTGAAGTAACTATCA
JMFN013G07+ GAGCCATCTACCATGTCAGCAGCTGGGCATGAAAGCCATCTCAAATTGAAGTAACTATCA
JMSF021H04+ GAGCCATCTACCATGTCAGCAGCTGGGCATGAAAGCCATCTCAAATTGAAGTAACTATCA
                      ____________________________________________________________
consensus GAGCCATCTACCATGTCAGCAGCTGGGCATGAAAGCCATCTCAAATTGAAGTAACTATCA
 
. : . : . : . : . : . :
rJMFF024K07- GGGTCTCTAGCAGCTTGCTGTTTGGAAAACTTTTCTCCACTGAGAGACTGAGCCACAATC
rJMSF021H04- GGGTCTCTAGCAGCTTGCTGTTTGGAAAACTTTTCTCCACTGAGAGACTGAGCCACAATC
JMFF023A21+ GGGTCTCTAGCAGCTTGCTGTTTGGAAAACTTTTCTCCACTGAGAGACTGAGCCACAATC
JMFF024K07+ GGGTCTCTAGCAGCTTGCTGTTTGGAAAACTTTTCTCCACTGAGAGACTGAGCCACAATC
JMFN013G07+ GGGTCTCTAGCAGCTTGCTGTTTGGAAAACTTTTCTCCACTGAGAGACTGAGCCACAATC
JMSF021H04+ GGGTCTCTAGCAGCTTGCTGTTTGGAAAACTTTTCTCCACTGAGAGACTGAGCCACAATC
                      ____________________________________________________________
consensus GGGTCTCTAGCAGCTTGCTGTTTGGAAAACTTTTCTCCACTGAGAGACTGAGCCACAATC
 
. : . : . : . : . : . :
rJMFF024K07- CCAGCATGGTCCCAACGGGTGGTGG
rJMSF021H04- CCAGCATGGTCCCAACGGGTGGTGGACTTGGTGAGACGCCTAACGAGAAGT
JMFF023A21+ CCAGCATGGTCCCAACGGGTGGTGGACTTGGTGAGACGCCTAACGAGAAGTGCCCCTCCG
JMFF024K07+ CCAGCATGGTCCCAACGGGTGGTGGACTTGGTGAGACGCCTAACGAGAAGTGCCCCTCCG
JMFN013G07+ CCAGCATGGTCCCAACGGGTGGTGGACTTGGTGAGACGCCTAACGAGAAGTGCCCCTCCG
JMFF048G20+ CGAGAAGTGCCCCTCCG
JMSF021H04+ CCAGCATGGTCCCAACGGGTGGTGGACTTGGTGAGACGCCTAACGAGAAGTGCCCCTCCG
                      ____________________________________________________________
consensus CCAGCATGGTCCCAACGGGTGGTGGACTTGGTGAGACGCCTAACGAGAAGTGCCCCTCCG
 
. : . : . : . : . : . :
JMFF023A21+ ATCAAAACCAGCGTCTTCAGCACCACCCCACGGGCTCGATCCCACCCATTCGGATTCTCC
JMFF024K07+ ATCAAAACCAGCGTCTTCAGCACCACCCCACGGGCTCGATCCCACCCATTCGGATTCTCC
JMFN013G07+ ATCAAAACCAGCGTCTTCAGCACCACCCCACGGGCTCGATCCCACCCATTCGGATTCTCC
JMFF048G20+ ATCAAAACCAGCGTCTTCAGCACCACCCCACGGGCTCGATCCCACCCATTCGGATTCTCC
JMSF021H04+ ATCAAAACCAGCGTCTTCAGCACCACCCCACGGGCTCGATCCCACCCATTCGGATTCTCC
                      ____________________________________________________________
consensus ATCAAAACCAGCGTCTTCAGCACCACCCCACGGGCTCGATCCCACCCATTCGGATTCTCC
 
. : . : . : . : . : . :
JMFF023A21+ TCCGACTTGGGGTCCAAACCCGAGTCCGAACCCGTACACATACTCGATTGAACCGCACTC
JMFF024K07+ TCCGACTTGGGGTCCAAACCCGAGTCCGAACCCGTACACATACTCGATTGAACCGCACTC
JMFN013G07+ TCCGACTTGGGGTCCAAACCCGAGTCCGAACCCGTACACATACTCGATTGAACCGCACTC
JMFF048G20+ TCCGACTTGGGGTCCAAACCCGAGTCCGAACCCGTACACATACTCGATTGAACCGCACTC
JMSF021H04+ TCCGACTTGGGGTCCAAACCCGAGTCCGAACCCGTACACATACTCGATTGAACCGCACTC
                      ____________________________________________________________
consensus TCCGACTTGGGGTCCAAACCCGAGTCCGAACCCGTACACATACTCGATTGAACCGCACTC
 
. : . : . : . : . : . :
JMFF023A21+ ACCAGCTCCCCAAAACCGGATGATTCTTCACGCCATCAACCAAC
JMFF024K07+ ACCAGCTCCCCAAAACCGGATGATTCTTCACGCCATCAATCAACAACTTAT
JMFN013G07+ ACCAGCTCCCCAAAACCGGATGATTCTTCACGCCATCAATCAACAACTTATACACTCTTC
JMFF048G20+ ACCAGCTCCCCAAAACCGGATGATTCTTCACGCCATCAATCAACAACTTATACACTCTTC
JMSF021H04+ ACCAGCTCCCCAAAACCGGATGATTCTTCACGCCATCAATCAACAACTTATACACTCTTC
                      ____________________________________________________________
consensus ACCAGCTCCCCAAAACCGGATGATTCTTCACGCCATCAATCAACAACTTATACACTCTTC
 
. : . : . : . : . : . :
JMFN013G07+ AACTCCAGAATTGCAAATTATATTTTCTCCTTCCGTGCG
JMFF048G20+ AACTCCAGAATTGCAAATTATATTTTCTCCTTCCGTGCGCCCTATCTCACT
JMSF021H04+ AACTCCAGAATTGCAAATTATATTTTCTCCTTCCGTGCGCCCTATCTCACTCTTCGTGTC
                      ____________________________________________________________
consensus AACTCCAGAATTGCAAATTATATTTTCTCCTTCCGTGCGCCCTATCTCACTCTTCGTGTC