Previous Contig 005981:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS076A08Sequence627005981 (3)gb:AY072209_15670962e-16Arabidopsis thaliana putative Rab geranylgeranyl transferase (At4g24490) mRNA, c
JMSF006F01Sequence414005981 (3)gb:AY072209_15670963e-20Arabidopsis thaliana putative Rab geranylgeranyl transferase (At4g24490) mRNA, c
JMSF021G15Sequence666005981 (3)gb:AY072209_15670963e-18Arabidopsis thaliana putative Rab geranylgeranyl transferase (At4g24490) mRNA, c723012193 (2)gb:AY072209_15670968e-38Arabidopsis thaliana putative Rab geranylgeranyl transferase (At4g24490) mRNA, c

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF006F01+ TCCTACGAAGAGTGGAATAAACATACTAGTCTAAGTTCTT
JMSF021G15+ GTTCTT
                      ____________________________________________________________
consensus TCCTACGAAGAGTGGAATAAACATACTAGTCTAAGTTCTT
 
. : . : . : . : . : . :
JMSF006F01+ CATCGAGAATTGCTTTGATAGACTCGGCATTGTTCTCAGTCTCAGATTGATTAAGTCGGA
JMFS076A08+ GATAGACTCGGCATTGTTCTCAGTCTCAGATTGATTAAGTCGGA
JMSF021G15+ CATCGAGAATTGCTTTGATAGACTCGGCATTGTTCTCAGTCTCAGATTGATTAAGTCGGA
                      ____________________________________________________________
consensus CATCGAGAATTGCTTTGATAGACTCGGCATTGTTCTCAGTCTCAGATTGATTAAGTCGGA
 
. : . : . : . : . : . :
JMSF006F01+ GATCTACAGCCAGCTTCCGGTAATTCCAAGCAGTGTAATGCTCCGGATTGGCCTCGAGCA
JMFS076A08+ GATCTACAGCCAGCTTCCGGTAATTCCAAGCAGTGTAATGCTCCGGATTGGCCTCGAGCA
JMSF021G15+ GATCTACAGCCAGCTTCCGGTAATTCCAAGCAGTGTAATGCTCCGGATTGGCCTCGAGCA
                      ____________________________________________________________
consensus GATCTACAGCCAGCTTCCGGTAATTCCAAGCAGTGTAATGCTCCGGATTGGCCTCGAGCA
 
. : . : . : . : . : . :
JMSF006F01+ GCTTCGCGCTGAGTTCTAGCGCTTCCTTATCATAAATTTTATTGTGATGAAAGTGGATGA
JMFS076A08+ GCTTCGCGCTGAGTTCTAGCGCTTCCTTATCATAAATTTTATTGTGATGAAAGTGGATGA
JMSF021G15+ GCTTCGCGCTGAGTTCTAGCGCTTCCTTATCATAAATTTTATTGTGATGAAAGTGGATGA
                      ____________________________________________________________
consensus GCTTCGCGCTGAGTTCTAGCGCTTCCTTATCATAAATTTTATTGTGATGAAAGTGGATGA
 
. : . : . : . : . : . :
JMSF006F01+ ACTGAGTTTGAAGAGATCGAAGCTTGGCGGCTTTGATCGCTGAAGCTTCTTGCTCTTCTT
JMFS076A08+ ACTGAGTTTGAAGAGATCGAAGCTTGGCGGCTTTGATCGCTGAAGCTTCTTGCTCTTCTT
JMSF021G15+ ACTGAGTTTGAAGAGATCGAAGCTTGGCGGCTTTGATCGCTGAAGCTTCTTGCTCTTCTT
                      ____________________________________________________________
consensus ACTGAGTTTGAAGAGATCGAAGCTTGGCGGCTTTGATCGCTGAAGCTTCTTGCTCTTCTT
 
. : . : . : . : . : . :
JMSF006F01+ GGCTTGGAGCTCTTCGTGGTCTTCCATGCATCTTTTCACACAATTTGTGGCCTG
JMFS076A08+ GGCTTGGAGCTCTTCGTGGTCTTCCATGCATCTTTTCACACAATTTGTGGCCAAAATGTC
JMSF021G15+ GGCTTGGAGCTCTTCGTGGTCTTCCATGCATCTTTTCACACAATTTGTGGCCAAAATGTC
                      ____________________________________________________________
consensus GGCTTGGAGCTCTTCGTGGTCTTCCATGCATCTTTTCACACAATTTGTGGCCAAAATGTC
 
. : . : . : . : . : . :
JMFS076A08+ CTTGACTATCGCGAAATTATCAATTTGGTCCTCTCAACTTTGTAAACGTTAACTAATATA
JMSF021G15+ CTTGACTATCGCGAAATTATCAATTTGGTCCTCTCAACTTTGTAAACGTTAACTAATATA
                      ____________________________________________________________
consensus CTTGACTATCGCGAAATTATCAATTTGGTCCTCTCAACTTTGTAAACGTTAACTAATATA
 
. : . : . : . : . : . :
JMFS076A08+ ATCCTCCGTCCTGTCAGGCGTCAAATTTTTGGTTAAGTTGAGGGTAATTACGGAATTTCA
JMSF021G15+ ATCCTCCGTCCTGTCAGGCGTCAAATTTTTGGTTAAGTTGAGGGTAATTACGGAATTTCA
                      ____________________________________________________________
consensus ATCCTCCGTCCTGTCAGGCGTCAAATTTTTGGTTAAGTTGAGGGTAATTACGGAATTTCA
 
. : . : . : . : . : . :
JMFS076A08+ CTTCAATTGCTGTTTTTCTCCTCTTCAAGCAATGTTCTTCCATTTCTGATTTTCTTCGGT
JMSF021G15+ CTTCAATTGCTGTTTTTCTCCTCTTCAAGCAATGTTCTTCCATTTCTGATTTTCTTCGGT
                      ____________________________________________________________
consensus CTTCAATTGCTGTTTTTCTCCTCTTCAAGCAATGTTCTTCCATTTCTGATTTTCTTCGGT
 
. : . : . : . : . : . :
JMFS076A08+ GAAGCCACAGTAGAAAAAGGCACAACTGTTCGAGAATCGACTCGAGGGTTTAATTCCAGA
JMSF021G15+ GAAGCCACAGTAGAAAAAGGCACAACTGTTCGAGAATCGACTCGAGGGTTTAATTCCAGA
                      ____________________________________________________________
consensus GAAGCCACAGTAGAAAAAGGCACAACTGTTCGAGAATCGACTCGAGGGTTTAATTCCAGA
 
. : . : . : . : . : . :
JMFS076A08+ GAGCATCGCCAACTCCCCAAATCTGCTCGAGCTGAAACTGTTCAAAAATTTAGGTTTGGA
JMSF021G15+ GAGCATCGCCAACTCCCCAAATCTGCTCGAGCTGAAACTGTTCAAAAATTTAGGTTTGGA
                      ____________________________________________________________
consensus GAGCATCGCCAACTCCCCAAATCTGCTCGAGCTGAAACTGTTCAAAAATTTAGGTTTGGA
 
. : . : . : . : . : . :
JMFS076A08+ GAAACTCTGATGAGCCCTTCCTCTCGAACCACTCTGAGCAGTC
JMSF021G15+ GAAACTCTGATGAGCCCTTCCTCTCGAACCACTCTGAGCAGTCTAAATGAATCGACGCCC
                      ____________________________________________________________
consensus GAAACTCTGATGAGCCCTTCCTCTCGAACCACTCTGAGCAGTCTAAATGAATCGACGCCC