Previous Contig 005980:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021B06Sequence711019191gb:AC002535_15308412e-18Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete sequence.>740005980 (4)gb:AC002535_15308416e-29Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete sequence.>
JMSF021G12Sequence697005980 (4)gb:AC002535_15308419e-36Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete sequence.>777012773 (3)gb:AC104272_17373523e-73Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s
JMSF021I05Sequence671005980 (4)gb:AC002535_15308413e-55Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete sequence.>772012773 (3)gb:AC104272_17373522e-75Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s
JMSF031E13Sequence694005980 (4)gb:AC002535_15308412e-40Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete sequence.>768012773 (3)gb:AC104272_17373522e-54Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021B06- ATCCTTTCCAGGGAATAATTCAG
                      ____________________________________________________________
consensus ATCCTTTCCAGGGAATAATTCAG
 
. : . : . : . : . : . :
rJMSF021B06- GAATATTGCTACAGTAACTAGTTCTATGCAAATGAAAAGGGAAAAAGAAAATAACGAAGT
                      ____________________________________________________________
consensus GAATATTGCTACAGTAACTAGTTCTATGCAAATGAAAAGGGAAAAAGAAAATAACGAAGT
 
. : . : . : . : . : . :
rJMSF021B06- ACCCCGATTAGCCAAATATATCTTGATCTTCTCATATGTTGGAAACTGGATAGCAACATG
                      ____________________________________________________________
consensus ACCCCGATTAGCCAAATATATCTTGATCTTCTCATATGTTGGAAACTGGATAGCAACATG
 
. : . : . : . : . : . :
rJMSF021B06- ACTAATACCCGCTAGAGCAGTCACAAGACCACTGACAACAATGAAAACATAAGTGATCAA
                      ____________________________________________________________
consensus ACTAATACCCGCTAGAGCAGTCACAAGACCACTGACAACAATGAAAACATAAGTGATCAA
 
. : . : . : . : . : . :
rJMSF021B06- CAAGCTTAACTACCTATGTGATGCATAATTCAAACATTCAAATAGAAGAATAACCCTAGA
                      ____________________________________________________________
consensus CAAGCTTAACTACCTATGTGATGCATAATTCAAACATTCAAATAGAAGAATAACCCTAGA
 
. : . : . : . : . : . :
rJMSF021B06- ATGCCCTTTTCACGAGCTATTCTTCTTAGAGCCGATAATGTACCCCGACAACACCAGCTC
JMSF021I05+ ACAAAACCAGCTC
                      ____________________________________________________________
consensus ATGCCCTTTTCACGAGCTATTCTTCTTAGAGCCGATAATGTACCCCGACAACACCAGCTC
 
. : . : . : . : . : . :
rJMSF021B06- TCATTCCTTGAGTCTGAAGTCTAGTCTTCACAACCCAAAGAGGATTTGTGGCAATTGTAG
JMSF021I05+ TCATTCCTTGAGTCTGAAGTCTAGTCTTCACAACCCAAAGAGGATTTGTGGCAATTGTTG
                      ____________________________________________________________
consensus TCATTCCTTGAGTCTGAAGTCTAGTCTTCACAACCCAAAGAGGATTTGTGGCAATTGTTG
 
. : . : . : . : . : . :
rJMSF021B06- TTGCAGCCCCAGCAGCAGCAGCAGCAAGCATGTTGGCACCAATAGAAAGTTTATGTCTTT
JMSF021I05+ TTGCAGCCCCAGCACCAGCAGCAGCAAGCATGTTGGCACCAATAGAAAGTTCATGTCTTT
JMSF031E13+ TTGCAGCCCCAGCACCAGCAGCAGCAAGCATGTTGGCACCAATAGAAAGTTCATGTC-TT
                      ____________________________________________________________
consensus TTGCAGCCCCAGCACCAGCAGCAGCAAGCATGTTGGCACCAATAGAAAGTTCATGTCTTT
 
. : . : . : . : . : . :
rJMSF021B06- CATCATCAGAGCAAAGAAAAGATTTCAGCTGCTCATAAATAGTAAAATAAACC
JMSF021I05+ CATCATCAGAGCAAAGAAAAGATTTCAGCTGCTCATAAATAGTAAAATAAACCGCCCAGT
JMSF031E13+ CATCATCAGAGCAAAGAAAAGATTTCAGCTGCTCATAAATAGTAAAATAAACCGCCCAGT
JMSF021G12+ TTCAGCTGCTCATAAATAGTAAAATAAACCGCCCAGT
                      ____________________________________________________________
consensus CATCATCAGAGCAAAGAAAAGATTTCAGCTGCTCATAAATAGTAAAATAAACCGCCCAGT
 
. : . : . : . : . : . :
JMSF021I05+ TTGGAAGTAATGCCAGAACTGTTGGAGAAAGCCCACGGTACATCCCCCGCAACCCCTCCC
JMSF031E13+ TTGGAAGTAATGCCAGAACTGTTGGAGAAAGCCCACGGTACATCCCCCGCAACCCCTCCC
JMSF021G12+ TTGGAAGTAATGCCAGAACTGTTGGAGAAAGCCCACGGTACATCCCCCGCAACCCCTCCC
                      ____________________________________________________________
consensus TTGGAAGTAATGCCAGAACTGTTGGAGAAAGCCCACGGTACATCCCCCGCAACCCCTCCC
 
. : . : . : . : . : . :
JMSF021I05+ TCTGGAATATCTGCTCTAAGCTACCAACTATAAGACTGCCTCTAATGTTAGTATTACCAA
JMSF031E13+ TCTGGAATATCTGCTCTAAGCTACCAACTATAAGACTGCCTCTAATGTTAGTATTACCAA
JMSF021G12+ TCTGGAATATCTGCTCTAAGCTACCAACTATAAGACTGCCTCTAATGTTAGTATTACCAA
                      ____________________________________________________________
consensus TCTGGAATATCTGCTCTAAGCTACCAACTATAAGACTGCCTCTAATGTTAGTATTACCAA
 
. : . : . : . : . : . :
JMSF021I05+ GCTTTGGAAGCCCATGAACCTGAAATCTTGTCTTTATAACATCTAAAGGACACACAAAAG
JMSF031E13+ GCTTTGGAAGCCCATGAACCTGAAATCTTGTCTTTATAACATCTAAAGGACACACAAAAG
JMSF021G12+ GCTTTGGAAGCCCATGAACCTGAAATCTTGTCTTTATAACATCTAAAGGACACACAAAAG
                      ____________________________________________________________
consensus GCTTTGGAAGCCCATGAACCTGAAATCTTGTCTTTATAACATCTAAAGGACACACAAAAG
 
. : . : . : . : . : . :
JMSF021I05+ TAGCTGCAATTACTCCGGCAGCGGCGCCTGCGCCGGCATTGCAGAGGAGGCCTTTAGGGC
JMSF031E13+ TAGCTGCAATTACTCCGGCAGCGGCGCCTGCGCCGGCATTGCAGAGGAGGCCTTTAGGGC
JMSF021G12+ TAGCTGCAATTACTCCGGCAGCGGCGCCTGCGCCGGCATTGCAGAGGAGGCCTTTAGGGC
                      ____________________________________________________________
consensus TAGCTGCAATTACTCCGGCAGCGGCGCCTGCGCCGGCATTGCAGAGGAGGCCTTTAGGGC
 
. : . : . : . : . : . :
JMSF021I05+ TAGGGCCATGAGCATCGGCAGTCATTGCTAAATCTACGGCGATCGAATCGAAAGAGGGCT
JMSF031E13+ TAGGGCCATGAGCATCGGCAGTCATTGCTAAATCTACGGCGATCGAATCGAAAGAGGGCT
JMSF021G12+ TAGGGCCATGAGCATCGGCAGTCATTGCTAAATCTACGGCGATCGAATCGAAAGAGGGCT
                      ____________________________________________________________
consensus TAGGGCCATGAGCATCGGCAGTCATTGCTAAATCTACGGCGATCGAATCGAAAGAGGGCT
 
. : . : . : . : . : . :
JMSF021I05+ GCGTGAGATGATGCTGCGGCAACAACGTCAACGGCGGGAACAATCTGTTTATTGGAGAAG
JMSF031E13+ GCGTGAGATGATGCTGCGGCAACAACGTCAACGGCGGGAACAATCTGTTTATTGGAGAAG
JMSF021G12+ GCGTGAGATGATGCTGCGGCAACAACGTCAACGGCGGGAACAATCTGTTTATTGGAGAAG
                      ____________________________________________________________
consensus GCGTGAGATGATGCTGCGGCAACAACGTCAACGGCGGGAACAATCTGTTTATTGGAGAAG
 
. : . : . : . : . : . :
JMSF021I05+ TCCTCTCTGGAGAGGCCAATAGCTGACAACCAGCGTCGCATGGCCAGTCGGTAGAGCTCG
JMSF031E13+ TCCTCTCTGGAGAGGCCAATAGCTGACAACCAGCGTCGCATGGCCAGTCGGTAGAGCTCG
JMSF021G12+ TCCTCTCTGGAGAGGCCAATAGCTGACAACCAGCGTCGCATGGCCAGTCGGTAGAGCTCG
                      ____________________________________________________________
consensus TCCTCTCTGGAGAGGCCAATAGCTGACAACCAGCGTCGCATGGCCAGTCGGTAGAGCTCG
 
. : . : . : . : . : . :
JMSF021I05+ GAACGAGCAATTCGAAGGAGCAAACCT
JMSF031E13+ GAACGAGCAATTCGAAGGAGCAAACCTATATATCTCCTCTATGACTGGCCTTTTTATCGT
JMSF021G12+ GAACGAGCAATTCGAAGGAGCAAACCTATATATCTCCTCTATGACTGGCCTTTTTATCGT
                      ____________________________________________________________
consensus GAACGAGCAATTCGAAGGAGCAAACCTATATATCTCCTCTATGACTGGCCTTTTTATCGT
 
. : . : . : . : . : . :
JMSF031E13+ CTTCCTCCCCGCAACAACCTGAAGAATTATAATGCCTGCGTTGTTGGGAGTTCGATGCGA
JMSF021G12+ CTTCCTCCCCGCAACAACCTGAAGAATTATAATGCCTGCGTTGTTGGGAGTTCGATGCGA
                      ____________________________________________________________
consensus CTTCCTCCCCGCAACAACCTGAAGAATTATAATGCCTGCGTTGTTGGGAGTTCGATGCGA
 
. : . : . : . : . : . :
JMSF031E13+ TCGAGAATCACAAACAGGAAAGCGATCTCACACT
JMSF021G12+ TCGAGAATCACAAACAGGAAAGCGATCTCACACTAATCCTCATCTGATCTGGGAGGGTAG
                      ____________________________________________________________
consensus TCGAGAATCACAAACAGGAAAGCGATCTCACACTAATCCTCATCTGATCTGGGAGGGTAG
 
. : . : . : . : . : . :
JMSF021G12+ GTTTTGGATCGAAGGAAGAAAATTATTGTCGACCATTGAACTACTCTCCACCAGACGATC
                      ____________________________________________________________
consensus GTTTTGGATCGAAGGAAGAAAATTATTGTCGACCATTGAACTACTCTCCACCAGACGATC