Previous Contig 005979:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001H13Sequence472000988 (10)gb:BT014978_16419484e-56Arabidopsis thaliana At4g19420 gene, complete cds.>gb:BT015714_1642332 Arabidops695005979 (12)pir|S68805|S688055e-52pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF003D13Sequence537000988 (10)gb:BT014978_16419488e-51Arabidopsis thaliana At4g19420 gene, complete cds.>gb:BT015714_1642332 Arabidops759005979 (12)pir|S68805|S688052e-67pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF010G02Sequence593000988 (10)gb:BT014978_16419483e-58Arabidopsis thaliana At4g19420 gene, complete cds.>gb:BT015714_1642332 Arabidops763005979 (12)pir|S68805|S688051e-67pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF017L13Sequence580000988 (10)gb:BT014978_16419488e-55Arabidopsis thaliana At4g19420 gene, complete cds.>gb:BT015714_1642332 Arabidops756005979 (12)pir|S68805|S688057e-33pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF019K04Sequence517000988 (10)800005979 (12)pir|S68805|S688052e-73pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF023O10Sequence459000988 (10)gb:AP004052_18369562e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12719005979 (12)pir|S68805|S688059e-55pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMFF041O12Sequence617000988 (10)pir|S68805|S688052e-64pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r620005979 (12)pir|S68805|S688055e-40pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMSF021G11Sequence579005979 (12)pir|S68805|S688054e-32pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r528005979 (12)pir|S68805|S688053e-32pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMSF023A01Sequence628000988 (10)pir|S68805|S688053e-63pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r702005979 (12)pir|S68805|S688052e-67pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMSF024F04Sequence681019343gb:AY063817_15657674e-90Arabidopsis thaliana unknown protein (At4g29330) mRNA, complete cds.>gb:AY096457777005979 (12)pir|S68805|S688054e-73pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r
JMSF044J19Sequence135000988 (10)684005979 (12)pir|S68805|S688052e-51pectin acetylesterase (EC 3.1.1.-) precursor - mung bean>gb:VRPECASE_1727361 V.r

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024F04+ CAATGATGNTGTTACAACGCATGGGTCAGCCNAGAATTTGCCTACTTCGTGTACATCAA
rJMFF019K04+ ACAATGATGTTGTTACAACGCATGGGTCAGCCAAGAATTTGCNTACTTCGTGTACATCAA
rJMFF017L13+ TCAA
rJMSF023A01+ GTGTACATCAA
rJMFF003D13+ GTGTACATCAA
rJMFF010G02+ GTGTACATCAA
                      ____________________________________________________________
consensus ACAATGATGTTGTTACAACGCATGGGTCAGCCAAGAATTTGCCTACTTCGTGTACATCAA
 
. : . : . : . : . : . :
rJMSF024F04+ AGATGAAGCCGGGATTGTGTTTTTTCCCGCAAAATATGGCACCAACTATTCAGACGCCTC
rJMFF019K04+ AGATGAAGCCGGGATTGTGTTTTTTCCCGCAAAATATGGCACCAACTATTCAGACGCCTC
rJMFF001H13+ ATTCAGACGCNTC
rJMFF023O10+ CCCGCAAAATATGGCACCAACTATTCAGACGCNTC
rJMFF017L13+ AGATGAAGCCGGGATTGTGTTTTTTCCCGCAAAATCTGGCACCAAC--TTCAGACGCCTC
rJMSF023A01+ AGATGAAGCCGGGATTGTGTTTTTTCCCGCAAAATATGGCACCAACTATTCAGACGCCTC
rJMSF044J19+ GGCACCATCTATTCAGACGCCTC
rJMFF003D13+ AGATGAAGCCGGGATTGTGTTTTTTCCCGCAAAATATGGCACCAACTATTCAGACGCCTC
rJMFF010G02+ AGATGAAGCCGGGATTGTGTTTTTTCCCGCAAAATATGGCACCAACTATTCAGACGCCTC
                      ____________________________________________________________
consensus AGATGAAGCCGGGATTGTGTTTTTTCCCGCAAAATATGGCACCAACTATTCAGACGCCTC
 
. : . : . : . : . : . :
rJMSF024F04+ TGTTCCTAGTCAATTCAGCTTATGATTCCTGGCAGGTAAAGAACATCTTGGCT-CCCGGG
rJMFF019K04+ TGTTCCTAGTCAATTCAGCTTATGATTCCTGGCAGGTAAAGAACATCTTGGCT-CCCGGG
rJMFF001H13+ TGTTCCTAGTCAATTCAGCTTATGATTCCTGGCAGGTAAAGAACATCTTGGCTNCCCGGG
rJMFF023O10+ TGTTCCTAGTCAATTCAGCTTATGATTCCTGGCAGGTAAAGAACATCTTGGCTCCCCGGG
rJMFF017L13+ TGTTCCTAGTCAATTCAGCTTATGATTCCTGGCAGGTAAAGAACATCTTGGCTCCCCGGG
rJMSF023A01+ TGTTCCTAGTCAATTCAGCTTATGATTCCTGGCAGGTAAAGAACATCTTGGCT-CCCGGG
rJMSF044J19+ TGNTCCTAGTCAATTCAGCTTATGANTCCTGGCAGGTAAAGAACATCTCGGCT-CCCGGG
rJMFF003D13+ TGTTCCTAGTCAATTCAGCTTATGATTCCTGGCAGGTAAAGAACATCTTGGCT-CCCGGG
rJMFF010G02+ TGTTCNTAGTCAATTCAGCTTATGATTCCTGGCAGGTAAAGAACATCTTGGCT-CCCGGG
                      ____________________________________________________________
consensus TGTTCCTAGTCAATTCAGCTTATGATTCCTGGCAGGTAAAGAACATCTTGGCT-CCCGGG
 
. : . : . : . : . : . :
rJMSF024F04+ GTAGCTGATCCCCACGGGACATGGCATAGCTGCAAGCTTGACATATTGAAATGCTCTGAT
rJMFF019K04+ GTAGCTGATCCCCACGGGACATGGCATAGCTGCAAGCTTGACATATTGAAATGCTCTGAT
rJMFF001H13+ GTAGCTGATCCCCACGGGACATGGCATAGCTGCAAGCTTGACATATTGAAATGCTCTGAT
rJMFF023O10+ GTAGCTGATCCCCACGGGACATGGCATAGCTGCAAGCTTGACATATTGAAATGCTCTGAT
rJMFF017L13+ GTAGCTGATCCCCACGGGACATGGCATAGCTGCAAGCTTGACATATTGAAATGCTCTGAT
rJMSF023A01+ GTAGCTGATCCCCACGGGACATGGCATAGCTGCAAGCTTGACATATTGAAATGCTCTGAT
rJMSF044J19+ GTAGCTGATCCCCACGGGACATGGCATAGCTGCAAGCTTGACATATTGAAATGCTNTGAT
rJMFF003D13+ GTAGCTGATCCCCACGGGACATGGCATAGCTGCAAGCTTGACATATTGAAATGCTCTGAT
rJMFF010G02+ GTAGCTGATCCCCACGGGACATGGCATAGCTGCAAGCTTGACATATTGAAATGCTCTGAT
rJMFF041O12+ GCTGCAAGCTTGACATATTGAAATGCTCTGAT
                      ____________________________________________________________
consensus GTAGCTGATCCCCACGGGACATGGCATAGCTGCAAGCTTGACATATTGAAATGCTCTGAT
 
. : . : . : . : . : . :
rJMSF024F04+ AGTCAGCT-TGGCATAATGCAAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
rJMFF019K04+ AGTCAGCT-TGGCATAATGCAAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
rJMFF001H13+ AGTCAGCT-TGGCATAATGCAAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
rJMFF023O10+ AGTCAGCT-TGGCATAATGCAAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
rJMFF017L13+ AGTCAGCTCNGGCATAATGCAAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
rJMSF023A01+ AGTCAGCT-TGGCATAATGCAAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
rJMSF044J19+ AGTCAGCT-TGGCATAATGCAAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
rJMFF003D13+ AGTCAGCT-TGGCATAATGCAAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
rJMFF010G02+ AGTCAGCT-TGGCATAATGCAAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
rJMFF041O12+ AGTCAGCT-TGGCATAATGCAAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
rJMSF021G11+ AAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
JMSF021G11- AAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
                      ____________________________________________________________
consensus AGTCAGCT-TGGCATAATGCAAGGTTTCAGGATGGAGTTCCTGAAGGCATTAGGTGCAGT
 
. : . : . : . : . : . :
rJMSF024F04+ AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
rJMFF019K04+ AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
rJMFF001H13+ AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
rJMFF023O10+ AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
rJMFF017L13+ AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
rJMSF023A01+ AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
rJMSF044J19+ AGCGAATTNTCCGTCGAGAGGATTCTTCATCAACTCCTGNTACGCCCACTGTCAGACCGA
rJMFF003D13+ AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
rJMFF010G02+ AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
rJMFF041O12+ AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
rJMSF021G11+ AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
JMSF021G11- AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
                      ____________________________________________________________
consensus AGCGAATTCTCCGTCGAGAGGATTCTTCATCAACTCCTGCTACGCCCACTGTCAGACCGA
 
. : . : . : . : . : . :
rJMSF024F04+ GGTCCAGGAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
rJMFF019K04+ GGTCCAGGAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
rJMFF001H13+ GGTCCAGGAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
rJMFF023O10+ GGTCCAGGAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
rJMFF017L13+ GGTCCAGGAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
rJMSF023A01+ GGTCCAGGAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
rJMSF044J19+ GGTCCAGGAGACATGGNTCAGGGACGACTCTCCCGTGTTGNCTGGCACGAGCATTGCCAA
rJMFF003D13+ GGTCCAGGAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
rJMFF010G02+ GGTCCAGGAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
rJMFF041O12+ GGTCCAGGAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
rJMSF021G11+ GGTCCAGTAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
JMSF021G11- GGTCCAGTAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
                      ____________________________________________________________
consensus GGTCCAGGAGACATGGCTCAGGGACGACTCTCCCGTGTTGGCTGGCACGAGCATTGCCAA
 
. : . : . : . : . : . :
rJMSF024F04+ AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
rJMFF019K04+ AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
rJMFF001H13+ AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
rJMFF023O10+ AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
rJMFF017L13+ AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCGCGTTGCCCTTATC
rJMSF023A01+ AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
rJMSF044J19+ AGCGGTTGGAGACTGGTACTATGNCAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
rJMFF003D13+ AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
rJMFF010G02+ AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
rJMFF041O12+ AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
rJMSF021G11+ AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
JMSF021G11- AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
                      ____________________________________________________________
consensus AGCGGTTGGAGACTGGTACTATGACAGAAGCCCGTTCCAGAAGATCG-ATTGCCCTTATC
 
. : . : . : . : . : . :
rJMSF024F04+ CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
rJMFF019K04+ CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
rJMFF001H13+ CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
rJMFF023O10+ CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
rJMFF017L13+ CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
rJMSF023A01+ CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
rJMSF044J19+ CTTGTGACAAATCATGCCACAATCGNGTATTNGAATAAGCGTTNTTCGGGAACCTTTTAC
rJMFF003D13+ CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
rJMFF010G02+ CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
rJMFF041O12+ CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
rJMSF021G11+ CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
JMSF021G11- CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
                      ____________________________________________________________
consensus CTTGTGACAAATCATGCCACAATCGCGTATTCGAATAAGCGTTCTTCGGGAACCTTTTAC
 
. : . : . : . : . : . :
rJMSF024F04+ TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
rJMFF019K04+ TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
rJMFF001H13+ TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
rJMFF023O10+ TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
rJMFF017L13+ TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
rJMSF023A01+ TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
rJMSF044J19+ TCCAAGTTNTGAAGANTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
rJMFF003D13+ TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
rJMFF010G02+ TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
rJMFF041O12+ TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
rJMSF021G11+ TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
JMSF021G11- TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
                      ____________________________________________________________
consensus TCCAAGTTGTGAAGATTCCCAGAAGGAGAAATCAGAAATGGGAAAGTGTTTGTTGATGAT
 
. : . : . : . : . : . :
rJMSF024F04+ GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
rJMFF019K04+ GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
rJMFF001H13+ GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
rJMFF023O10+ GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
rJMFF017L13+ GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
rJMSF023A01+ GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
rJMSF044J19+ GATGATGATATANGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
rJMFF003D13+ GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
rJMFF010G02+ GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
rJMFF041O12+ GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
rJMSF021G11+ GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
JMSF021G11- GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
                      ____________________________________________________________
consensus GATGATGATATATGTCAAGTGTTCAGAATAAAGGAATCACACCATTGCAGAGGTATCTTG
 
. : . : . : . : . : . :
rJMSF024F04+ GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
rJMFF019K04+ GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
rJMFF001H13+ GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
rJMFF023O10+ GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
rJMFF017L13+ GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
rJMSF023A01+ GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
rJMSF044J19+ GTNTTTTGTCTNTAAGGCTCAAATNTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
rJMFF003D13+ GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
rJMFF010G02+ GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
rJMFF041O12+ GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
rJMSF021G11+ GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
JMSF021G11- GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
                      ____________________________________________________________
consensus GTGTTTTGTCTCTAAGGCTCAAATTTGTACCTTAATAACTGTAATTGAGTAGTACTTGTT
 
. : . : . : . : . : . :
rJMSF024F04+ TTCAATGGTATCCTGCCTA-CAAGTTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
rJMFF019K04+ TTCAATGGTATCCTGCCTA-CAAGTTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
rJMFF001H13+ TTCAATGGTATCCTGCCTA-CAAGTTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
rJMFF023O10+ TTCAATGGTATCCTGCCTA-CAAGTTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
rJMFF017L13+ TTCAATGGTATCCTGCCTA-CAAGTTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
rJMSF023A01+ TTCAATGGTATCCTGCCTACCAAGTTAGGAGATT
rJMSF044J19+ TTCAATGGTATCCNGCCTA-CAAGNTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
rJMFF003D13+ TTCAATGGTATCCTGCCTA-CAAGTTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
rJMFF010G02+ TTCAATGGTATCCTGCCTA-CAAGTTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
rJMFF041O12+ TTCAATGGTATCCTGCCTA-CAAGTTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
rJMSF021G11+ TTCAATGGTATCCTGCCTA-CAAGTTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
JMSF021G11- TTCAATGGTATCCTGCCTA-CAAGTTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
                      ____________________________________________________________
consensus TTCAATGGTATCCTGCCTA-CAAGTTAGGAGATTGGGATACAATGAAGAGGAAAATGTTA
 
. : . : . : . : . : . :
rJMSF024F04+ TT
rJMFF019K04+ TTTGTAATTTTTAATTGCACGAAA
rJMFF001H13+ TTTGTAATTTTTAA-TGCACGAAAAT
rJMFF023O10+ TTTGTAATTTTTAATTGCACGAAAATA
rJMFF017L13+ TTTGTAATTTTTAATTGCACGAAAATAATAT
rJMSF044J19+ TT
rJMFF003D13+ TTTGTAATTTTTAATTGCACGAAAATAATATA
rJMFF010G02+ TTTGTAATTTTTAATTGCACGAAAATAATATA
rJMFF041O12+ TTTGTAATTTTTAATTGCACGAAAATAATATAATGGCCTTACTATTTTA
rJMSF021G11+ TTTGTAATT
JMSF021G11- TTTGTAATTTTTAATTGCACGAAAATAATATAATGGCCTTACTATTTTAGAAAAAAAAAA
                      ____________________________________________________________
consensus TTTGTAATTTTTAATTGCACGAAAATAATATAATGGCCTTACTATTTTAGAAAAAAAAAA