Previous Contig 005977:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002K24Sequence474005977 (4)588000710 (5)pir|B86346|B863463e-06F16F4.4 protein - Arabidopsis thaliana>gb:AE005172_891085 Arabidopsis thaliana c
JMFS062B01Sequence630005977 (4)pir|A84616|A846161e-07hypothetical protein At2g22720 [imported] - Arabidopsis thaliana
JMFS062D10Sequence606005977 (4)pir|A84616|A846161e-07hypothetical protein At2g22720 [imported] - Arabidopsis thaliana
JMSF021G02Sequence664005977 (4)pir|A84616|A846162e-07hypothetical protein At2g22720 [imported] - Arabidopsis thaliana777022982gb:AY542311_16127448e-08Sorghum bicolor clone SB20O07 b1-1, b1-2, putative genetic modifier, hypothetica

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021G02+ TNGG
                      ____________________________________________________________
consensus TNGG
 
. : . : . : . : . : . :
JMFS062D10+ GTCTCGCAGAGTTCGAGGCATGAA
JMFS062B01+ CATGGTTACTGGTACTGGACTTTGGTCTCGCAGAGTTCGAGGCATGAA
JMSF021G02+ AAACTTTTGGTGCATGGTTACTGGTACTGGACTTTGGTCTCGCAGAGTTCGAGGCATGAA
                      ____________________________________________________________
consensus AAACTTTTGGTGCATGGTTACTGGTACTGGACTTTGGTCTCGCAGAGTTCGAGGCATGAA
 
. : . : . : . : . : . :
JMFS062D10+ CCTTATTACCACTAGCAATATTTTTCCTCATAACTTTATCTGCCAAATCAGGGTTCTCCA
JMFS062B01+ CCTTATTACCACTAGCAATATTTTTCCTCATAACTTTATCTGCCAAATCAGGGTTCTCCA
JMSF021G02+ CCTTATTACCACTAGCAATATTTTTCCTCATAACTTTATCTGCCAAATCAGGGTTCTCCA
                      ____________________________________________________________
consensus CCTTATTACCACTAGCAATATTTTTCCTCATAACTTTATCTGCCAAATCAGGGTTCTCCA
 
. : . : . : . : . : . :
JMFS062D10+ ATAAGGACTTGCTTTCTTGAATTACTCTTTGAGCTATAACTGGCTGTGATGGTCCAAAGA
JMFS062B01+ ATAAGGACTTGCTTTCTTGAATTACTCTTTGAGCTATAACTGGCTGTGATGGTCCAAAGA
JMSF021G02+ ATAAGGACTTGCTTTCTTGAATTACTCTTTGAGCTATAACTGGCTGTGATGGTCCAAAGA
                      ____________________________________________________________
consensus ATAAGGACTTGCTTTCTTGAATTACTCTTTGAGCTATAACTGGCTGTGATGGTCCAAAGA
 
. : . : . : . : . : . :
JMFS062D10+ AGGAACCAAAATTATCCTTGGATGAAGAACTCTTGATATTACGGGAACTGGAAGCACTTC
JMFS062B01+ AGGAACCAAAATTATCCTTGGATGAAGAACTCTTGATATTACGGGAACTGGAAGCACTTC
JMFF002K24+ CCAAAATTATCCNTGGATGAAGAACCCTTGATATTACGGGAACTGGAAGCACTTC
JMSF021G02+ AGGAACCAAAATTATCCTTGGATGAAGAACTCTTGATATTACGGGAACTGGAAGCACTTC
                      ____________________________________________________________
consensus AGGAACCAAAATTATCCTTGGATGAAGAACTCTTGATATTACGGGAACTGGAAGCACTTC
 
. : . : . : . : . : . :
JMFS062D10+ CAGTTCCCATCTCTTTCTTCATCTTCTTTCTAAATCTTTCTTTCAGTTTTTGCCTTAGTT
JMFS062B01+ CAGTTCCCATCTCTTTCTTCATCTTCTTTCTAAATCTTTCTTTCAGTTTTTGCCTTAGTT
JMFF002K24+ CAGTTCCCATCTCTTTCTTCATCTTCTTTCTAAATCTTTCTTTCAGTTTTTGCCTTAGTT
JMSF021G02+ CAGTTCCCATCTCTTTCTTCATCTTCTTTCTAAATCTTTCTTTCAGTTTTTGCCTTAGTT
                      ____________________________________________________________
consensus CAGTTCCCATCTCTTTCTTCATCTTCTTTCTAAATCTTTCTTTCAGTTTTTGCCTTAGTT
 
. : . : . : . : . : . :
JMFS062D10+ CCAAATATTCCAACTCCTCCATTGAAGGCTCATGTGTTTCTTCCTGCTCACACTCCTCCT
JMFS062B01+ CCAAATATTCCAACTCCTCCATTGAAGGCTCATGTGTTTCTTCCTGCTCACACTCCTCCT
JMFF002K24+ CCAAATATTCCAACTCCTCCATTGAAGGCTCATGTGTTTCTTCCTGCTCACACTCCTCCT
JMSF021G02+ CCAAATATTCCAACTCCTCCATTGAAGGCTCATGTGTTTCTTCCTGCTCACACTCCTCCT
                      ____________________________________________________________
consensus CCAAATATTCCAACTCCTCCATTGAAGGCTCATGTGTTTCTTCCTGCTCACACTCCTCCT
 
. : . : . : . : . : . :
JMFS062D10+ CCTCTTCATAGCCCCCTTCCTCATCTTCACCATCCTCTTCATACTCATCCAAATCCTCAT
JMFS062B01+ CCTCTTCATAGCCCCCTTCCTCATCTTCACCATCCTCTTCATACTCATCCAAATCCTCAT
JMFF002K24+ CCTCTTCATAGCCCCCTTCCTCATCTTCACCATCCTCTTCATACTCATCCAAATCCTCAT
JMSF021G02+ CCTCTTCATAGCCCCCTTCCTCATCTTCACCATCCTCTTCATACTCATCCAAATCCTCAT
                      ____________________________________________________________
consensus CCTCTTCATAGCCCCCTTCCTCATCTTCACCATCCTCTTCATACTCATCCAAATCCTCAT
 
. : . : . : . : . : . :
JMFS062D10+ ATTCATCACTGGCATATCTCGACATAGCTGGTTGAATCATTCAATGTGATTACAAATTGT
JMFS062B01+ ATTCATCACTGGCATATCTCGACATAGCTGGTTGAATCATTCAATGTGATTACAAATTGT
JMFF002K24+ ATTCATCACTGGCATATCTCGACATAGCTGGTTGAATCATTCAATGTGATTACAAATTGT
JMSF021G02+ ATTCATCACTGGCATATCTCGACATAGCTGGTTGAATCATTCAATGTGATTACAAATTGT
                      ____________________________________________________________
consensus ATTCATCACTGGCATATCTCGACATAGCTGGTTGAATCATTCAATGTGATTACAAATTGT
 
. : . : . : . : . : . :
JMFS062D10+ ACACAGAAAGCCTGAATCGATGCTGAAAAAGCTGGGGAATCAGTCAAAACGATCGGAAAA
JMFS062B01+ ACACAGAAAGCCTGAATCGATGCTGAAAAAGCTGGGGAATCAGTCAAAACGATCGGAAAA
JMFF002K24+ ACACAGAAAGCCTGAATCGATGCTGAAAAAGCTGGGGAATCAGTCAAAACGATCGGAAAA
JMSF021G02+ ACACAGAAAGCCTGAATCGATGCTGAAAAAGCTGGGGAATCAGTCAAAACGATCGGAAAA
                      ____________________________________________________________
consensus ACACAGAAAGCCTGAATCGATGCTGAAAAAGCTGGGGAATCAGTCAAAACGATCGGAAAA
 
. : . : . : . : . : . :
JMFS062D10+ GGCGAAATCGAGCGCAGATGCGAAGAGAGCAAATCCGAGGGATTTCAGATCTGGAGAAAC
JMFS062B01+ GGCGAAATCGAGCGCAGATGCGAAGAGAGCAAATCCGAGGGATTTCAGATCTGGAGAAAC
JMFF002K24+ GGCGAAATCGAGCGCAGATGCGAAGAGAGCAAATCCGAGGGATTTCAGATCTGGAGAAAC
JMSF021G02+ GGCGAAATCGAGCGCAGATGCGAAGAGAGCAAATCCGAGGGATTTCAGATCTGGAGAAAC
                      ____________________________________________________________
consensus GGCGAAATCGAGCGCAGATGCGAAGAGAGCAAATCCGAGGGATTTCAGATCTGGAGAAAC
 
. : . : . : . : . : . :
JMFS062D10+ GGCTAATGCGAATATATGCACGTAGAAGGCGCGACGACGGAG
JMFS062B01+ GGCTAATGCGAATATATGCACGTAGAAGGCGCGACGACGGAG
JMFF002K24+ GGCTAATGCGAATATATGCACGTAGAAGGCGCGACGACGGAGGGATGCGTTGAGAAAT
JMSF021G02+ GGCTAATGCGAATATATGCACGTAGAAGGCGCGACGACGGAGGGATGCGTTGAGAAATTC
                      ____________________________________________________________
consensus GGCTAATGCGAATATATGCACGTAGAAGGCGCGACGACGGAGGGATGCGTTGAGAAATTC