Previous Contig 005974:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS098B07Sequence626005974 (2)gb:AP003237_18259621e-67Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P004
JMSF021F10Sequence666005974 (2)gb:AP003237_18259622e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P004767022979gb:AE005172_8896692e-73Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC007592_153599

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021F10+ TTCCAA
                      ____________________________________________________________
consensus TTCCAA
 
. : . : . : . : . : . :
JMFS098B07+ ATTAAGCCTCGCCCCAGTTAACGCAAAATACTCCCCAAATC
JMSF021F10+ GTGCAACCAGTTCTTTACCATTAAGCCTCGCCCCAGTTAACGCAAAATACTCCCCAAATC
                      ____________________________________________________________
consensus GTGCAACCAGTTCTTTACCATTAAGCCTCGCCCCAGTTAACGCAAAATACTCCCCAAATC
 
. : . : . : . : . : . :
JMFS098B07+ TGCCCGGAAGGCGAGAGTGAATATATGAGAATCCACAGTCAGTATGAAACCCAATACTTG
JMSF021F10+ TGCCCGGAAGGCGAGAGTGAATATATGAGAATCCACAGTCAGTATGAAACCCAATACTTG
                      ____________________________________________________________
consensus TGCCCGGAAGGCGAGAGTGAATATATGAGAATCCACAGTCAGTATGAAACCCAATACTTG
 
. : . : . : . : . : . :
JMFS098B07+ CTTCTGGAGTAGAAAAAACTGTCTTTTCAGTTACAACAGAGAACTTCATTGGGACCATCA
JMSF021F10+ CTTCTGGAGTAGAAAAAACTGTCTTTTCAGTTACAACAGAGAACTTCATTGGGACCATCA
                      ____________________________________________________________
consensus CTTCTGGAGTAGAAAAAACTGTCTTTTCAGTTACAACAGAGAACTTCATTGGGACCATCA
 
. : . : . : . : . : . :
JMFS098B07+ ACGATGCACCTCCACCCATTGAAATGCCATGAACTAGAGCAACCTGGGGTTTTTTATAGG
JMSF021F10+ ACGATGCACCTCCACCCATTGAAATGCCATGAACTAGAGCAACCTGGGGTTTTTTATAGG
                      ____________________________________________________________
consensus ACGATGCACCTCCACCCATTGAAATGCCATGAACTAGAGCAACCTGGGGTTTTTTATAGG
 
. : . : . : . : . : . :
JMFS098B07+ TGTGGATATGGTAACAAAGCCAATACATCCGGTAAACAACTTCAAGGCAAGAATCCTTTG
JMSF021F10+ TGTGGATATGGTAACAAAGCCAATACATCCGGTAAACAACTTCAAGGCAAGAATCCTTTG
                      ____________________________________________________________
consensus TGTGGATATGGTAACAAAGCCAATACATCCGGTAAACAACTTCAAGGCAAGAATCCTTTG
 
. : . : . : . : . : . :
JMFS098B07+ GTGTCCTGCCATCATAAAACATTTTCAAGTCCCCACCAGCAGAATAAGCACGCCCAGCTC
JMSF021F10+ GTGTCCTGCCATCATAAAACATTTTCAAGTCCCCACCAGCAGAATAAGCACGCCCAGCTC
                      ____________________________________________________________
consensus GTGTCCTGCCATCATAAAACATTTTCAAGTCCCCACCAGCAGAATAAGCACGCCCAGCTC
 
. : . : . : . : . : . :
JMFS098B07+ CCTTGAGGATGATGAGAGCTGCATTGTCATCTTTCTCCCATTTTTCCAGGTTTTGAGCCA
JMSF021F10+ CCTTGAGGATGATGAGAGCTGCATTGTCATCTTTCTCCCATTTTTCCAGGTTTTGAGCCA
                      ____________________________________________________________
consensus CCTTGAGGATGATGAGAGCTGCATTGTCATCTTTCTCCCATTTTTCCAGGTTTTGAGCCA
 
. : . : . : . : . : . :
JMFS098B07+ GCAATTTTACCACTTCAGATGAAATGACATTCAATTGCTTGGGACGGTTTAAGGTGATCA
JMSF021F10+ GCAATTTTACCACTTCAGATGAAATGACATTCAATTGCTTGGGACGGTTTAAGGTGATCA
                      ____________________________________________________________
consensus GCAATTTTACCACTTCAGATGAAATGACATTCAATTGCTTGGGACGGTTTAAGGTGATCA
 
. : . : . : . : . : . :
JMFS098B07+ ATCTAGCATTGCCAACTTCTTCAGCCAGAACAACCT
JMSF021F10+ ATCTAGCATTGCCAACTTCTTCAGCCAGAACAACCTCTCCATCTAGGTGTGCTGTTTCCT
                      ____________________________________________________________
consensus ATCTAGCATTGCCAACTTCTTCAGCCAGAACAACCTCTCCATCTAGGTGTGCTGTTTCCT
 
. : . : . : . : . : . :
JMSF021F10+ GTGACATCTTCCTAGCCAATTAAGCAGGTATAGCTAATCACTCCCAGCAAGATGAATTCA
                      ____________________________________________________________
consensus GTGACATCTTCCTAGCCAATTAAGCAGGTATAGCTAATCACTCCCAGCAAGATGAATTCA
 
. : . : . : . : . : . :
JMSF021F10+ ACTTGTGAATTTGGGTCTGTTCTACCACCCTCCACAGACTTGTCTTCAACACCAGAATCC
                      ____________________________________________________________
consensus ACTTGTGAATTTGGGTCTGTTCTACCACCCTCCACAGACTTGTCTTCAACACCAGAATCC