Previous Contig 005967:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011G20Sequence473005967 (2)pir|A86319|A863191e-12F25I16.11 protein - Arabidopsis thaliana>gb:AE005172_890815 Arabidopsis thaliana749020897pir|A86319|A863191e-11F25I16.11 protein - Arabidopsis thaliana>gb:AE005172_890815 Arabidopsis thaliana
JMSF021E08Sequence585005967 (2)pir|A86319|A863192e-12F25I16.11 protein - Arabidopsis thaliana>gb:AE005172_890815 Arabidopsis thaliana745022976pir|A86319|A863195e-28F25I16.11 protein - Arabidopsis thaliana>gb:AE005172_890815 Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021E08+ TCTCCGCCGCCCACAGTTGCCGCCGCCGCCGCAGCCACGTTTTCCTT
                      ____________________________________________________________
consensus TCTCCGCCGCCCACAGTTGCCGCCGCCGCCGCAGCCACGTTTTCCTT
 
. : . : . : . : . : . :
JMFF011G20+ TCCTCATCCGGCGGCCGGTGTAGCGGCGGCGGAGGTTGCCAAATGGGCATTGTGTTCTC
JMSF021E08+ CTCCTCATCCGGCGGCCGGTGTAGCGGCGGCGGAGGTTGCCAAATGGGCATTGTGTTCTC
                      ____________________________________________________________
consensus CTCCTCATCCGGCGGCCGGTGTAGCGGCGGCGGAGGTTGCCAAATGGGCATTGTGTTCTC
 
. : . : . : . : . : . :
JMFF011G20+ CTTCATCACGTTACCAAATGGTCTGGGCTCTTTGCCGTCTTTTCCGTCCTTTTTCGCAGA
JMSF021E08+ CTTCATCACGTTACCAAATGGTCTGGGCTCTTTGCCGTCTTTTCCGTCCTTTTTCGCAGA
                      ____________________________________________________________
consensus CTTCATCACGTTACCAAATGGTCTGGGCTCTTTGCCGTCTTTTCCGTCCTTTTTCGCAGA
 
. : . : . : . : . : . :
JMFF011G20+ GTTGAGGAGATCCACACTAGGGTGCGTGGTGAATCTTGNATCCTCGGCCTTTAAAGACTG
JMSF021E08+ GTTGAGGAGATCCACACTAGGGTGCGTGGTGAATCTTGGATCCTCGGCCTTTAAAGACTG
                      ____________________________________________________________
consensus GTTGAGGAGATCCACACTAGGGTGCGTGGTGAATCTTGGATCCTCGGCCTTTAAAGACTG
 
. : . : . : . : . : . :
JMFF011G20+ GTTCTTGAGCGCCATTGAGGCTCGCTTTTGCTGCTCATACAAAAGGCTCAGAGCTTTCAT
JMSF021E08+ GTTCTTGAGCGCCATTGAGGCTCGCTTTTGCTGCTCATACAAAAGGCTCAGAGCTTTCAT
                      ____________________________________________________________
consensus GTTCTTGAGCGCCATTGAGGCTCGCTTTTGCTGCTCATACAAAAGGCTCAGAGCTTTCAT
 
. : . : . : . : . : . :
JMFF011G20+ CTTCTCTTTCAACCCATGGTGCGGGTTTCTCATCGCCGCGGCGGCGGCGGCGGCGGAACC
JMSF021E08+ CTTCTCTTTCAACCCATGGTGCGGGTTTCTCATCGCCGCGGCGGCGGCGGCGGCGGAACC
                      ____________________________________________________________
consensus CTTCTCTTTCAACCCATGGTGCGGGTTTCTCATCGCCGCGGCGGCGGCGGCGGCGGAACC
 
. : . : . : . : . : . :
JMFF011G20+ CACTCCATCGAGTTCTTGAATTTCCGGCTTGGCTCTGGTTTTGCTGCTAGTGATCTGAGA
JMSF021E08+ CACTCCATCGAGTTCTTGAATTTCCGGCTTGGCTCTGGTTTTGCTGCTAGTGATCTGAGA
                      ____________________________________________________________
consensus CACTCCATCGAGTTCTTGAATTTCCGGCTTGGCTCTGGTTTTGCTGCTAGTGATCTGAGA
 
. : . : . : . : . : . :
JMFF011G20+ TCTTGTTGAAACCGGCATTTTCATCTGCAAAAACCTGGACCCTATCTACTGAAACTGCTA
JMSF021E08+ TCTTGTTGAAACCGGCATTTT--TCTGCAAAAACCTGGACCCTATCTACTGAAACTGCTA
                      ____________________________________________________________
consensus TCTTGTTGAAACCGGCATTTTCATCTGCAAAAACCTGGACCCTATCTACTGAAACTGCTA
 
. : . : . : . : . : . :
JMFF011G20+ GAAGCCTAGAACTGCAAAAAGTCAAGAACTTTGTCGTCGAAAAATCAAGAATTT
JMSF021E08+ GAAGCCTAGAACTGCAAAAAGTCAAGAACTTTGTCGTCGAAAAATCAAGAATTTGATGGT
                      ____________________________________________________________
consensus GAAGCCTAGAACTGCAAAAAGTCAAGAACTTTGTCGTCGAAAAATCAAGAATTTGATGGT
 
. : . : . : . : . : . :
JMSF021E08+ GCCATGCCAGCGAAGCGAACAGTAGAAGAGGGAGCTAAAATGGGAAGAGAGTGAAGGGCC
                      ____________________________________________________________
consensus GCCATGCCAGCGAAGCGAACAGTAGAAGAGGGAGCTAAAATGGGAAGAGAGTGAAGGGCC