Previous Contig 005963:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009B18Sequence279005963 (2)766011486 (2)pir|T04270|T042701e-25hypothetical protein F20B18.260 - Arabidopsis thaliana>gb:ATCHRIV64_1546496 Arab
JMSF021D18Sequence643005963 (2)757011486 (2)pir|T04270|T042701e-25hypothetical protein F20B18.260 - Arabidopsis thaliana>gb:ATCHRIV64_1546496 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021D18+ CCGCCATTGTTGGAGGAGGAGCTGTGGNCTGCTGTGATCAGTT
                      ____________________________________________________________
consensus CCGCCATTGTTGGAGGAGGAGCTGTGGNCTGCTGTGATCAGTT
 
. : . : . : . : . : . :
JMSF021D18+ TCCAAGGAAGAAGATAATGATGGCCCCTTTTGATGATGATCTTCAATCTTCGTTGCACTA
                      ____________________________________________________________
consensus TCCAAGGAAGAAGATAATGATGGCCCCTTTTGATGATGATCTTCAATCTTCGTTGCACTA
 
. : . : . : . : . : . :
JMSF021D18+ ACATTAATTTTCACCACTTCCATGTTTGCGCGATCTGAACTACTCCTCACCTTCTTCACC
                      ____________________________________________________________
consensus ACATTAATTTTCACCACTTCCATGTTTGCGCGATCTGAACTACTCCTCACCTTCTTCACC
 
. : . : . : . : . : . :
JMSF021D18+ AACTTCATCTTTGCAGGCATCATCATCACTTTCTCTGGACTTTTCTCACCTTCATTCTCA
                      ____________________________________________________________
consensus AACTTCATCTTTGCAGGCATCATCATCACTTTCTCTGGACTTTTCTCACCTTCATTCTCA
 
. : . : . : . : . : . :
JMSF021D18+ TATTTCTCCTCTTCTTTCCTCCACTTATTATGCCCACTTTCTGCCTGCCCTTTCTTGGCC
                      ____________________________________________________________
consensus TATTTCTCCTCTTCTTTCCTCCACTTATTATGCCCACTTTCTGCCTGCCCTTTCTTGGCC
 
. : . : . : . : . : . :
JMSF021D18+ TCCATATTATCATATGATCCCCAATTATCATTCGCGTTTGGGGCCGGTGGCTGGTAAAAT
                      ____________________________________________________________
consensus TCCATATTATCATATGATCCCCAATTATCATTCGCGTTTGGGGCCGGTGGCTGGTAAAAT
 
. : . : . : . : . : . :
JMSF009B18+ GATCATAGTTCAAGAAAAGATGGGAAGATGAAGGGTGATTATTATTGGAAGATGAA
JMSF021D18+ TGAGGATCATAGTTCAAGAAAAGATGGGAAGATGAAGGGTGATTATTATTGGAAGATGAA
                      ____________________________________________________________
consensus TGAGGATCATAGTTCAAGAAAAGATGGGAAGATGAAGGGTGATTATTATTGGAAGATGAA
 
. : . : . : . : . : . :
JMSF009B18+ GAAGCTGCAGCTTGATAGTTTGATGATGAAGTAAAGAAAAGATTGGGGTTTTGATCATCA
JMSF021D18+ GAAGCTGCAGCTTGATAGTTTGATGATGAAGTAAAGAAAAGATTGGGGTTTTGATCATCA
                      ____________________________________________________________
consensus GAAGCTGCAGCTTGATAGTTTGATGATGAAGTAAAGAAAAGATTGGGGTTTTGATCATCA
 
. : . : . : . : . : . :
JMSF009B18+ TCATACTGATCTGCAGTGGTGTAATTGAGGTCAAAAGGGAAAGGAGAAGATGAAGAAGAA
JMSF021D18+ TCATACTGATCTGCAGTGGTGTAATTGAGGTCAAAAGGGAAAGGAGAAGATGAAGAAGAA
                      ____________________________________________________________
consensus TCATACTGATCTGCAGTGGTGTAATTGAGGTCAAAAGGGAAAGGAGAAGATGAAGAAGAA
 
. : . : . : . : . : . :
JMSF009B18+ GTCATGTAAGTAGGGATCATGGGGAAGAGAGACCAATAGAATTCAGAGATTTGGGTTTAT
JMSF021D18+ GTCATGTAAGTAGGGATCATGGGGAAGAGAGACCAATAGAATTCAGAGATTTGGGTTTAT
                      ____________________________________________________________
consensus GTCATGTAAGTAGGGATCATGGGGAAGAGAGACCAATAGAATTCAGAGATTTGGGTTTAT
 
. : . : . : . : . : . :
JMSF009B18+ GATCAGAGAATTGAATTGAAGGAAGATATATGGGTGCAGGAT
JMSF021D18+ GATCAGAGAATTGAATTGAAGGAAGATATATGGGTGCAGGATAGTTGCAAATAAAGGTCC
                      ____________________________________________________________
consensus GATCAGAGAATTGAATTGAAGGAAGATATATGGGTGCAGGATAGTTGCAAATAAAGGTCC