Previous Contig 005961:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS029C04Sequence603005961 (8)gb:AB084266_15242491e-55Arabidopsis thaliana WNK1 mRNA for Ser/Thr kinase, complete cds.>gb:AC009465_153
JMFS077E01Sequence640005961 (8)gb:AB084266_1524249e-102Arabidopsis thaliana WNK1 mRNA for Ser/Thr kinase, complete cds.>gb:AC009465_153
JMFS131G03Sequence642005961 (8)gb:AB084266_15242494e-90Arabidopsis thaliana WNK1 mRNA for Ser/Thr kinase, complete cds.>gb:AC009465_153
JMSF006C16Sequence257005961 (8)gb:AB084266_15242491e-13Arabidopsis thaliana WNK1 mRNA for Ser/Thr kinase, complete cds.>gb:AC009465_153320011338 (4)
JMSF006J18Sequence400005961 (8)gb:AB084266_15242498e-43Arabidopsis thaliana WNK1 mRNA for Ser/Thr kinase, complete cds.>gb:AC009465_153
JMSF007G07Sequence381005961 (8)gb:AB084266_15242494e-66Arabidopsis thaliana WNK1 mRNA for Ser/Thr kinase, complete cds.>gb:AC009465_153800011338 (4)gb:AB084266_15242491e-05Arabidopsis thaliana WNK1 mRNA for Ser/Thr kinase, complete cds.>gb:AC009465_153
JMSF021D13Sequence702005961 (8)gb:AB084266_15242491e-55Arabidopsis thaliana WNK1 mRNA for Ser/Thr kinase, complete cds.>gb:AC009465_153252022973
JMSF030E04Sequence641005961 (8)gb:AB084266_15242495e-88Arabidopsis thaliana WNK1 mRNA for Ser/Thr kinase, complete cds.>gb:AC009465_153748011338 (4)gb:AB084266_15242490.002Arabidopsis thaliana WNK1 mRNA for Ser/Thr kinase, complete cds.>gb:AC009465_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS077E01+ ACTTCGGGAGCCATGAATTCCGGAGTTC
                      ____________________________________________________________
consensus ACTTCGGGAGCCATGAATTCCGGAGTTC
 
. : . : . : . : . : . :
JMFS077E01+ CTACACAACGAGCAGCATGGGATTTACGGAGGATTGCAGCGAGGCCAAGATCACCAATTT
                      ____________________________________________________________
consensus CTACACAACGAGCAGCATGGGATTTACGGAGGATTGCAGCGAGGCCAAGATCACCAATTT
 
. : . : . : . : . : . :
JMSF007G07+ CTGGTTACCATTGATAAATATGTTGTCGCACTTGAGGTCTCTATGGATAA
JMFS077E01+ TGACTTCCCCCTGGTTACCATTGATAAATATGTTGTCGCACTTGAGGTCTCTATGGATAA
                      ____________________________________________________________
consensus TGACTTCCCCCTGGTTACCATTGATAAATATGTTGTCGCACTTGAGGTCTCTATGGATAA
 
. : . : . : . : . : . :
JMSF007G07+ CCGGAGGGGCACGGCTATGGAGGTAGAGAAGGCCTTCCAATATCTGTTTACACCAATGCT
JMFS077E01+ CCGGAGGGGCACGGCTATGGAGGTAGAGAAGGCCTTCCAATATCTGTTTACACCAATGCT
                      ____________________________________________________________
consensus CCGGAGGGGCACGGCTATGGAGGTAGAGAAGGCCTTCCAATATCTGTTTACACCAATGCT
 
. : . : . : . : . : . :
JMSF007G07+ TCACTGCCCTAATGTTAACCCTCTTGTGTTTCAACCTATACTGTCTTAAAGTACCAGAGG
JMFS077E01+ TCACTGCCCTAATGTTAACCCTCTTGTGTTTCAACCTATACTGTCTTAAAGTACCAGAGG
JMFS029C04+ TACTGTCTTAAAGTACCAGAGG
JMFS131G03+ TACTGTCTTAAAGTACCAGAGG
JMSF030E04+ TACTGTCTTAAAGTACCAGAGG
JMSF021D13+ TACTGTCTTAAAGTACCAGAGG
                      ____________________________________________________________
consensus TCACTGCCCTAATGTTAACCCTCTTGTGTTTCAACCTATACTGTCTTAAAGTACCAGAGG
 
. : . : . : . : . : . :
JMSF007G07+ TGAACATCTCAGTCACAAAGTTGATGTTTCTGTTCTCAGTATCAACCCAAGAAGTGTAAA
JMFS077E01+ TGAACATCTCAGTCACAAAGTTGATGTTTCTGTTCTCAGTATCAACCCAAGAAGTGTAAA
JMFS029C04+ TGAACATCTCAGTCACAAAGTTGATGTTTCTGTTCTCAGTATCAACCCAAGAAGTGTAAA
JMFS131G03+ TGAACATCTCAGTCACAAAGTTGATGTTTCTGTTCTCAGTATCAACCCAAGAAGTGTAAA
JMSF030E04+ TGAACATCTCAGTCACAAAGTTGATGTTTCTGTTCTCAGTATCAACCCAAGAAGTGTAAA
JMSF006J18+ AGAAGTGTAAA
JMSF021D13+ TGAACATCTCAGTCACAAAGTTGATGTTTCTGTTCTCAGTATCAACCCAAGAAGTGTAAA
                      ____________________________________________________________
consensus TGAACATCTCAGTCACAAAGTTGATGTTTCTGTTCTCAGTATCAACCCAAGAAGTGTAAA
 
. : . : . : . : . : . :
JMSF007G07+ ATTTCATGATGTTCTTGTGCTTTAGGGTCTTGAGCAGGTGAATTTCACAATATAACCTCT
JMFS077E01+ ATTTCATGATGTTCTTGTGCTTTAGGGTCTTGAGCAGGTGAATTTCACAATATAACCTCT
JMFS029C04+ ATTTCATGATGTTCTTGTGCTTTAGGGTCTTGAGCAGGTGAATTTCACAATATAACCTCT
JMFS131G03+ ATTTCATGATGTTCTTGTGCTTTAGGGTCTTGAGCAGGTGAATTTCACAATATAACCTCT
JMSF030E04+ ATTTCATGATGTTCTTGTGCTTTAGGGTCTTGAGCAGGTGAATTTCACAATATAACCTCT
JMSF006J18+ ATTTCATGATGTTCTTGTGCTTTAGGGTCTTGAGCAGGTGAATTTCACAATATAACCTCT
JMSF021D13+ ATTTCATGATGTTCTTGTGCTTTAGGGTCTTGAGCAGGTGAATTTCACAATATAACCTCT
                      ____________________________________________________________
consensus ATTTCATGATGTTCTTGTGCTTTAGGGTCTTGAGCAGGTGAATTTCACAATATAACCTCT
 
. : . : . : . : . : . :
JMSF007G07+ CAAGGTCTTCTGGGCTTTGCATAAAGTCATGAAGTTTCACCTGATTCCAGGCCACCTCAA
JMFS077E01+ CAAGGTCTTCTGGGCTTTGCATAAAGTCATGAAGTTTCACCTGATTCCAGGCCACCTCAA
JMFS029C04+ CAAGGTCTTCTGGGCTTTGCATAAAGTCATGAAGTTTCACCTGATTCCAGGCCACCTCAA
JMFS131G03+ CAAGGTCTTCTGGGCTTTGCATAAAGTCATGAAGTTTCACCTGATTCCAGGCCACCTCAA
JMSF030E04+ CAAGGTCTTCTGGGCTTTGCATAAAGTCATGAAGTTTCACCTGATTCCAGGCCACCTCAA
JMSF006J18+ CAAGGTCTTCTGGGCTTTGCATAAAGTCATGAAGTTTCACCTGATTCCAGGCCACCTCAA
JMSF021D13+ CAAGGTCTTCTGGGCTTTGCATAAAGTCATGAAGTTTCACCTGATTCCAGGCCACCTCAA
                      ____________________________________________________________
consensus CAAGGTCTTCTGGGCTTTGCATAAAGTCATGAAGTTTCACCTGATTCCAGGCCACCTCAA
 
. : . : . : . : . : . :
JMSF007G07+ TTCCTTCATACTCATCAAAAGCTCTATAAAC
JMFS077E01+ TTCCTTCATACTCATCAAAAGCTCTATAAACAGTCTTGGAAGCCCCTTTACCAAGAATTT
JMFS029C04+ TTCCTTCATACTCATCAAAAGCTCTATAAACAGTCTTGGAAGCCCCTTTACCAAGAATTT
JMFS131G03+ TTCCTTCATACTCATCAAAAGCTCTATAAACAGTCTTGGAAGCCCCTTTACCAAGAATTT
JMSF030E04+ TTCCTTCATACTCATCAAAAGCTCTATAAACAGTCTTGGAAGCCCCTTTACCAAGAATTT
JMSF006J18+ TTCCTTCATACTCATCAAAAGCTCTATAAACAGTCTTGGAAGCCCCTTTACCAAGAATTT
JMSF006C16+ CATCAAAAGCTCTATAAACAGTCTTGGAAGCCCCTTTACCAAGAATTT
JMSF021D13+ TTCCTTCATACTCATCAAAAGCTCTATAAACAGTCTTGGAAGCCCCTTTACCAAGAATTT
                      ____________________________________________________________
consensus TTCCTTCATACTCATCAAAAGCTCTATAAACAGTCTTGGAAGCCCCTTTACCAAGAATTT
 
. : . : . : . : . : . :
JMFS077E01+ CATTGTACCTTCCATATCTTCCAGTAGGATCAACCTCAACAAACTCAGAATCATCTGATT
JMFS029C04+ CATTGTACCTTCCATATCTTCCAGTAGGATCAACCTCAACAAACTCAGAATCATCTGATT
JMFS131G03+ CATTGTACCTTCCATATCTTCCAGTAGGATCAACCTCAACAAACTCAGAATCATCTGATT
JMSF030E04+ CATTGTACCTTCCATATCTTCCAGTAGGATCAACCTCAACAAACTCAGAATCATCTGATT
JMSF006J18+ CATTGTACCTTCCATATCTTCCAGTAGGATCAACCTCAACAAACTCAGAATCATCTGATT
JMSF006C16+ CATTGTACCTTCCATATCTTCCAGTAGGATCAACCTCAACAAACTCAGAATCATCTGATT
JMSF021D13+ CATTGTACCTTCCATATCTTCCAGTAGGATCAACCTCAACAAACTCAGAATCATCTGATT
                      ____________________________________________________________
consensus CATTGTACCTTCCATATCTTCCAGTAGGATCAACCTCAACAAACTCAGAATCATCTGATT
 
. : . : . : . : . : . :
JMFS077E01+ CTATCTCAGTGACATTATCCATTCCCTTCAATCTTCTCCCCAAATTATTCTTCACCTAAT
JMFS029C04+ CTATCTCAGTGACATTATCCATTCCCTTCAATCTTCTCCCCAAATTATTCTTCACCTAAT
JMFS131G03+ CTATCTCAGTGACATTATCCATTCCCTTCAATCTTCTCCCCAAATTATTCTTCACCTAAT
JMSF030E04+ CTATCTCAGTGACATTATCCATTCCCTTCAATCTTCTCCCCAAATTATTCTTCACTTAAT
JMSF006J18+ CTATCTCAGTGACATTATCCATTCCCTTCAATCTTCTCCCCAAATTATTCTTCACCTAAT
JMSF006C16+ CTATCTCAGTGACATTATCCATTCCCTTCAATCTTCTCCCCAAATTATTCTTCACCTAAT
JMSF021D13+ CTATCTCAGTGACATTATCCATTCCCTTCAATCTTCTCCCCAAATTATTCTTCACCTAAT
                      ____________________________________________________________
consensus CTATCTCAGTGACATTATCCATTCCCTTCAATCTTCTCCCCAAATTATTCTTCACCTAAT
 
. : . : . : . : . : . :
JMFS077E01+ GTTCTTGATTTT
JMFS029C04+ GTTCTTGATTTTTTTGGCAGTGCAGAGAGAAA
JMFS131G03+ GTTCTTGATTTTTTTGGCAGTGCAGAGAGAAAGAAAGAAAGAAACATGGTTTGGCAGTCC
JMSF030E04+ GTTCTTGATTTTTTTGGCAGTGCAGAGAGAAAGAAAGAAAGAAACATGGTTTGGCAGTCC
JMSF006J18+ GTTCTTGATTTTTTTGGCAGTGCAGAGAGAAAGAAAGAAAGAAACATGGTTTGGCAGTCC
JMSF006C16+ GTTCTTGATTTTTTTGGCAGTGCAGAGAGAAAGAAAGAAAGAAACATGGTTTGGCAGTCC
JMSF021D13+ GTTCTTGATTTTTTTGGCAGTGCAGAGAGAAAGAAAGAAAGAAACATGGTTTGGCAGTCC
                      ____________________________________________________________
consensus GTTCTTGATTTTTTTGGCAGTGCAGAGAGAAAGAAAGAAAGAAACATGGTTTGGCAGTCC
 
. : . : . : . : . : . :
JMFS131G03+ TGGAGATTTTATGGTGGAA
JMSF030E04+ TGGAGATTTTATGGTGGAAGAAAATCC
JMSF006J18+ TGGAGATTTTATGGTGGAAGAAAATCC
JMSF006C16+ TGGAGATTTTATGGTGGAAGAAAATCC
JMSF021D13+ TGGAGATTTTATGGTGGAAGAAAATCCCGGGTGTACTTTCATTGCTAGGCTGTGGTTTTT
                      ____________________________________________________________
consensus TGGAGATTTTATGGTGGAAGAAAATCCCGGGTGTACTTTCATTGCTAGGCTGTGGTTTTT
 
. : . : . : . : . : . :
JMSF021D13+ AAAACAAAAATAAAAAAAATAAAAATAAAGAAAGAAAGAGAAAAAAGAACCTATAAATTC
                      ____________________________________________________________
consensus AAAACAAAAATAAAAAAAATAAAAATAAAGAAAGAAAGAGAAAAAAGAACCTATAAATTC