Previous Contig 005958:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001A21Sequence601005958 (4)gb:BT012662_16417323e-63Arabidopsis thaliana At3g23540 gene, complete cds.662008162 (4)gb:BT012662_16417322e-06Arabidopsis thaliana At3g23540 gene, complete cds.
JMFF016F07Sequence605005958 (4)gb:BT012662_16417327e-94Arabidopsis thaliana At3g23540 gene, complete cds.653008162 (4)gb:BT012662_16417322e-06Arabidopsis thaliana At3g23540 gene, complete cds.
JMSF020M02Sequence669005958 (4)gb:BT012662_16417329e-70Arabidopsis thaliana At3g23540 gene, complete cds.747008162 (4)gb:BT012662_16417322e-11Arabidopsis thaliana At3g23540 gene, complete cds.
JMSF021C20Sequence673005958 (4)gb:BT012662_16417329e-70Arabidopsis thaliana At3g23540 gene, complete cds.806008162 (4)gb:BT012662_16417324e-17Arabidopsis thaliana At3g23540 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF016F07+ GTAAGTGTCAACAAGTTCCATC
                      ____________________________________________________________
consensus GTAAGTGTCAACAAGTTCCATC
 
. : . : . : . : . : . :
JMFF016F07+ ATCAAATCAACCAAATCAGAGAAAGGGCTGTCCAAAACCATTCCGGCAATAGAAGGATAC
                      ____________________________________________________________
consensus ATCAAATCAACCAAATCAGAGAAAGGGCTGTCCAAAACCATTCCGGCAATAGAAGGATAC
 
. : . : . : . : . : . :
JMFF016F07+ TCAGCTCCATACATCAGACTTGTAACAGCACCCATTGATCTACCCCACAAGCCAATTAAA
JMSF020M02+ CAAGCCAATTAAA
JMSF021C20+ CAAGCCAATTAAA
                      ____________________________________________________________
consensus TCAGCTCCATACATCAGACTTGTAACAGCACCCATTGATCTACCCCACAAGCCAATTAAA
 
. : . : . : . : . : . :
JMFF016F07+ GAAACATTTCCATCTTGCCGTAAATACTCAACAACAGCTTTAAGATCATCTTTTTCATTC
JMFF001A21+ ATACTCAACAACAGCTTTAAGATCATCTTTTTCATTC
JMSF020M02+ GAAACATTTCCATCTTGCCGTAAATACTCAACAACAGCTTTAAGATCATCTTTTTCATTC
JMSF021C20+ GAAACATTTCCATCTTGCCGTAAATACTCAACAACAGCTTTAAGATCATCTTTTTCATTC
                      ____________________________________________________________
consensus GAAACATTTCCATCTTGCCGTAAATACTCAACAACAGCTTTAAGATCATCTTTTTCATTC
 
. : . : . : . : . : . :
JMFF016F07+ CATCCCAAAGTAACATGCTCTCCCCCAGACAGTCCAGATCCAGAAAAGTCAAGGGTGAAT
JMFF001A21+ CATCCCAAAGTAACATGCTCTCCCCCAGACAGTCCAGATCCAGAAAAGTCAAGGGTGAAT
JMSF020M02+ CATCCCAAAGTAACATGCTCTCCCCCAGACAGTCCAGATCCAGAAAAGTCAAGGGTGAAT
JMSF021C20+ CATCCCAAAGTAACATGCTCTCCCCCAGACAGTCCAGATCCAGAAAAGTCAAGGGTGAAT
                      ____________________________________________________________
consensus CATCCCAAAGTAACATGCTCTCCCCCAGACAGTCCAGATCCAGAAAAGTCAAGGGTGAAT
 
. : . : . : . : . : . :
JMFF016F07+ ACAGTAATATTTGATGGCAATAATATAATGGCAGCTTCGCTGGCATCTGCTCGACAGCCA
JMFF001A21+ ACAGTAATATTTGATGGCAATAATATAATGGCAGCTTCGCTGGCATCTGCTCGACAGCCA
JMSF020M02+ ACAGTAATATTTGATGGCAATAATATAATGGCAGCTTCGCTGGCATCTGCTCGACAGCCA
JMSF021C20+ ACAGTAATATTTGATGGCAATAATATAATGGCAGCTTCGCTGGCATCTGCTCGACAGCCA
                      ____________________________________________________________
consensus ACAGTAATATTTGATGGCAATAATATAATGGCAGCTTCGCTGGCATCTGCTCGACAGCCA
 
. : . : . : . : . : . :
JMFF016F07+ CTGTTTCCATGACAGTAGATTACACAGGGCAGAGGCTTTCCTTCAGGACAAATGATAGGT
JMFF001A21+ CTGTTTCCATGACAGTAGATTACACAGGGCAGAGGCTTTCCTTCAGGACAAATGATAGGT
JMSF020M02+ CTGTTTCCATGACAGTAGATTACACAGGGCAGAGGCTTTCCTTCAGGACAAATGATAGGT
JMSF021C20+ CTGTTTCCATGACAGTAGATTACACAGGGCAGAGGCTTTCCTTCAGGACAAATGATAGGT
                      ____________________________________________________________
consensus CTGTTTCCATGACAGTAGATTACACAGGGCAGAGGCTTTCCTTCAGGACAAATGATAGGT
 
. : . : . : . : . : . :
JMFF016F07+ ATGTAATGGCTACATTTAAGAGCATCACCCCGACTGTTTTTAACCTCCAAATCCTTCCGT
JMFF001A21+ ATGTAATGGCTACATTTAAGAGCATCACCCCGACTGTTTTTAACCTCCAAATCCTTCCGT
JMSF020M02+ ATGTAATGGCTACATTTAAGAGCATCACCCCGACTGTTTTTAACCTCCAAATCCTTCCGT
JMSF021C20+ ATGTAATGGCTACATTTAAGAGCATCACCCCGACTGTTTTTAACCTCCAAATCCTTCCGT
                      ____________________________________________________________
consensus ATGTAATGGCTACATTTAAGAGCATCACCCCGACTGTTTTTAACCTCCAAATCCTTCCGT
 
. : . : . : . : . : . :
JMFF016F07+ TGGTACCACTTCCCTTTGAGCATGAATTCTTCATCTAGTAAATCATTCTTTGGGTCATAT
JMFF001A21+ TGGTACCACTTCCCTTTGAGCATGAATTCTTCATCTAGTAAATCATTCTTTGGGTCATAT
JMSF020M02+ TGGTACCACTTCCCTTTGAGCATGAATTCTTCATCTAGTAAATCATTCTTTGGGTCATAT
JMSF021C20+ TGGTACCACTTCCCTTTGAGCATGAATTCTTCATCTAGTAAATCATTCTTTGGGTCATAT
                      ____________________________________________________________
consensus TGGTACCACTTCCCTTTGAGCATGAATTCTTCATCTAGTAAATCATTCTTTGGGTCATAT
 
. : . : . : . : . : . :
JMFF016F07+ TCAGCTCTGGGTGGTCTTATAATGAAGTTGACAAGCTGTTCCATACAGATTCAATGGCCA
JMFF001A21+ TCAGCTCTGGGTGGTCTTATAATGAAGTTGACAAGCTGTTCCATACAGATTCAATGGCCA
JMSF020M02+ TCAGCTCTGGGTGGTCTTATAATGAAGTTGACAAGCTGTTCCATACAGATTCAATGGCCA
JMSF021C20+ TCAGCTCTGGGTGGTCTTATAATGAAGTTGACAAGCTGTTCCATACAGATTCAATGGCCA
                      ____________________________________________________________
consensus TCAGCTCTGGGTGGTCTTATAATGAAGTTGACAAGCTGTTCCATACAGATTCAATGGCCA
 
. : . : . : . : . : . :
JMFF016F07+ ATCGATCTTCTCTCTCTAAATATAAATGTATAGAGAAATACAC
JMFF001A21+ ATCGATCTTCTCTCTCTAAATATAAATGTATAGAGAAATACACTGGTTACATGTATGTAT
JMSF020M02+ ATCGATCTTCTCTCTCTAAATATAAATGTATAGAGAAATACACTGGTTACATGTATGTAT
JMSF021C20+ ATCGATCTTCTCTCTCTAAATATAAATGTATAGAGAAATACACTGGTTACATGTATGTAT
                      ____________________________________________________________
consensus ATCGATCTTCTCTCTCTAAATATAAATGTATAGAGAAATACACTGGTTACATGTATGTAT
 
. : . : . : . : . : . :
JMFF001A21+ TTACATTATATATAAGATAGATAGATATATATATAATTTATATGCATGGGTTAAGGTGGG
JMSF020M02+ TTACATTATATATAAGATAGATAGATATATATATAATTTATATGCATGGGTTAAGGTGGG
JMSF021C20+ TTACATTATATATAAGATAGATAGATATATATATAATTTATATGCATGGGTTAAGGTGGG
                      ____________________________________________________________
consensus TTACATTATATATAAGATAGATAGATATATATATAATTTATATGCATGGGTTAAGGTGGG
 
. : . : . : . : . : . :
JMFF001A21+ TAGAGAGAGAAAGAGGAATAAAAAGGGGAGGGAGCACTGTGGTAAGAGTTATGGGTTTGC
JMSF020M02+ TAGAGAGAGAAAGAGGAATAAAAAGGGGAGGGAGCACTGTGGTAAGAGTTATGGGTTTGC
JMSF021C20+ TAGAGAGAGAAAGAGGAATAAAAAGGGGAGGGAGCACTGTGGTAAGAGTTATGGGTTTGC
                      ____________________________________________________________
consensus TAGAGAGAGAAAGAGGAATAAAAAGGGGAGGGAGCACTGTGGTAAGAGTTATGGGTTTGC
 
. : . : . : . : . : . :
JMFF001A21+ TTTCAGAGGAGAAGGTCAGAAGAG
JMSF020M02+ TTTCAGAGGAGAAGGTCAGAAGAGGAAGAAACGAAGCGCTTTTGTTTGGCTTCTC
JMSF021C20+ TTTCAGAGGAGAAGGTCAGAAGAGGAAGAAACGAAGCGCTTTTGTTTGGCTTCTCTTCCA
                      ____________________________________________________________
consensus TTTCAGAGGAGAAGGTCAGAAGAGGAAGAAACGAAGCGCTTTTGTTTGGCTTCTCTTCCA