Previous Contig 005953:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011C07Sequence385005953 (19)sp|O04979|LON1_SPIOL5e-27Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142731008694 (4)gb:AB026197_15169056e-71Lithospermum erythrorhizon mitochondrial mRNA for LON protease homologue, partia
JMFS002A09Sequence513005953 (19)sp|O04979|LON1_SPIOL2e-58Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS038D10Sequence615005953 (19)sp|O04979|LON1_SPIOL7e-65Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS040E03Sequence497005953 (19)sp|O04979|LON1_SPIOL3e-65Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS058C08Sequence627005953 (19)sp|O04979|LON1_SPIOL2e-72Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS089G01Sequence627005953 (19)sp|O04979|LON1_SPIOL4e-69Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS089G08Sequence592005953 (19)sp|O04979|LON1_SPIOL5e-65Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS105B01Sequence625005953 (19)sp|O04979|LON1_SPIOL3e-67Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS107E01Sequence627005953 (19)sp|O04979|LON1_SPIOL2e-72Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS134B11Sequence618005953 (19)sp|O04979|LON1_SPIOL6e-65Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS140C08Sequence625005953 (19)sp|O04979|LON1_SPIOL3e-67Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS142C03Sequence617005953 (19)sp|O04979|LON1_SPIOL7e-60Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS160F12Sequence593005953 (19)sp|O04979|LON1_SPIOL4e-69Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS164G12Sequence586005953 (19)sp|O04979|LON1_SPIOL1e-58Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMFS165H09Sequence595005953 (19)sp|O04979|LON1_SPIOL1e-59Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142
JMSF014G01Sequence259005953 (19)sp|O64948|LON1_ARATH3e-09Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>gb:AB013394_15121788008694 (4)gb:AB026197_15169059e-89Lithospermum erythrorhizon mitochondrial mRNA for LON protease homologue, partia
JMSF019P21Sequence296005953 (19)gb:AF385580_17945571e-10Dichanthelium lanuginosum Lon protease (lon) mRNA, complete cds.647008694 (4)gb:AB026197_15169053e-57Lithospermum erythrorhizon mitochondrial mRNA for LON protease homologue, partia
JMSF021C01Sequence688005953 (19)sp|O04979|LON1_SPIOL3e-67Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142737008694 (4)gb:AB026197_15169052e-73Lithospermum erythrorhizon mitochondrial mRNA for LON protease homologue, partia
JMSF021G06Sequence663005953 (19)sp|O04979|LON1_SPIOL2e-67Lon protease homolog 1, mitochondrial precursor (EC 3.4.21.-).>pir|T09142|T09142

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS107E01+ AGACAATGCAATGAAT
JMFS058C08+ AGACAATGCAATGAAT
                      ____________________________________________________________
consensus AGACAATGCAATGAAT
 
. : . : . : . : . : . :
JMFS107E01+ TCCTGGTCTTGCTCAACTTGCTCCATC-TCAGGCTTGGTCATATCAAGAGAAGTAATCCG
JMFS160F12+ TCAACTTGCTCCATC-TCAGGCTTGGTCATATCAAGAGAAGTAATCCG
JMFS058C08+ TCCTGGTCTTGCTCAACTTGCTCCATC-TCAGGCTTGGTCATATCAAGAGAAGTAATCCG
JMFS140C08+ TGCTCCATCNTCAGGCTTGGTCATATCAAGAGAAGTAATCCG
JMFS089G01+ TCAACTTGCTCCATC-TCAGGCTTGGTCATATCAAGAGAAGTAATCCG
JMFS105B01+ CAGGCTTGGTCATATCAAGAGAAGTAATCCG
JMSF021G06+ TC-TCAGGCTTGGTCATATCAAGAGAAGTAATCCG
JMFS134B11+ AGAAGTAATCCG
JMFS038D10+ GTAATCCG
JMFS142C03+ AGTAATCCG
JMFS089G08+ AGAAGTAATCCG
JMFS040E03+ AGAAGTAATCCG
JMSF021C01+ CAGGCTTGGTCATATCAAGAGAAGTAATCCG
                      ____________________________________________________________
consensus TCCTGGTCTTGCTCAACTTGCTCCATC-TCAGGCTTGGTCATATCAAGAGAAGTAATCCG
 
. : . : . : . : . : . :
JMFS107E01+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMFS160F12+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMFS058C08+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMFS140C08+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMFS002A09+ ACTGAATCTGCATAATCCTTC
JMFS089G01+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMFS105B01+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMSF021G06+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMFS134B11+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMFS038D10+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMFS142C03+ TGCTGTATAATATGTT-CTCTGGTGCTCAGCTCTGGCACACTGAATCTGCATAATCCTTC
JMFS165H09+ CTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMFS089G08+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMFS164G12+ TGCACACTGAATCTGCATAATCCTTC
JMFS040E03+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
JMSF021C01+ TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
                      ____________________________________________________________
consensus TGCTGTATAATATGTTCCTCTTGTGCTCAGCTCTTGCACACTGAATCTGCATAATCCTTC
 
. : . : . : . : . : . :
JMFS107E01+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS160F12+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS058C08+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS140C08+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS002A09+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS089G01+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS105B01+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMSF021G06+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS134B11+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS038D10+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS142C03+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS165H09+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS089G08+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS164G12+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMFS040E03+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
JMSF021C01+ TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
                      ____________________________________________________________
consensus TAGCACAACTATGTAAGTGACCCTCCCACTTGGTTTTTCCACTCCTCTTGAGAGATGCAG
 
. : . : . : . : . : . :
JMFS107E01+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS160F12+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS058C08+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS140C08+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS002A09+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS089G01+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS105B01+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMSF021G06+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS134B11+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS038D10+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS142C03+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS165H09+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS089G08+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS164G12+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMFS040E03+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
JMSF021C01+ AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
                      ____________________________________________________________
consensus AGCCCGAGCAGCAACTCCTCGGTTATGCCAGTGAATAACTTCCTGCTGATTTTTGCCATC
 
. : . : . : . : . : . :
JMFS107E01+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS160F12+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS058C08+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS140C08+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS002A09+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS089G01+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS105B01+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMSF021G06+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS134B11+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS038D10+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS142C03+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS165H09+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS089G08+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS164G12+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMFS040E03+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
JMSF021C01+ ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
                      ____________________________________________________________
consensus ATGTTTGTGAGACTCTGATGTACCAGCCTGATTTTTCGGTGTGCGGTCAGCTGAATCAGT
 
. : . : . : . : . : . :
JMFS107E01+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS160F12+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS058C08+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS140C08+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS002A09+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS089G01+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS105B01+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMSF021G06+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS134B11+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS038D10+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS142C03+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS165H09+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS089G08+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS164G12+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFS040E03+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMFF011C07+ CCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
JMSF021C01+ TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
                      ____________________________________________________________
consensus TACCACGCCTGGAGATAAAGTAGGAGCAACAGTAGTAGTCTCTGCAGAATCCCGGACAGG
 
. : . : . : . : . : . :
JMFS107E01+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS160F12+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS058C08+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS140C08+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS002A09+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS089G01+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS105B01+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMSF021G06+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS134B11+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS038D10+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS142C03+ GAGAACCCCAATCAGTCCCTTCTGTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS165H09+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS089G08+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS164G12+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMFS040E03+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMSF019P21+ TGCCACAACTCTTGCTCCACCAGTTTCAC
JMFF011C07+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
JMSF021C01+ GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
                      ____________________________________________________________
consensus GAGAACCCCAATCAGTCCCTTCTCTTCTCTCTGCCACAACTCTTGCTCCACCAGTTTCAC
 
. : . : . : . : . : . :
JMFS107E01+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS160F12+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS058C08+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS140C08+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS002A09+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS089G01+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS105B01+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMSF021G06+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS134B11+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS038D10+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS142C03+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS165H09+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS089G08+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS164G12+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFS040E03+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMSF019P21+ ACT--GAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMSF014G01+ GAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMFF011C07+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
JMSF021C01+ ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
                      ____________________________________________________________
consensus ACTGCGAGGCGAAGTGCAGCGAATTCGAATTATAGCGCCAGGCAACAGCACTTTGTTCCT
 
. : . : . : . : . : . :
JMFS107E01+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS160F12+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS058C08+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS140C08+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS002A09+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS089G01+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS105B01+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMSF021G06+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS134B11+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS038D10+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS142C03+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS165H09+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS089G08+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS164G12+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFS040E03+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMSF019P21+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMSF014G01+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMFF011C07+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
JMSF021C01+ GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
                      ____________________________________________________________
consensus GAACGGAAGAATCGCTAGACGACCGGGGAGCTCAACAGATTCCGCCATGCTTCTTCTCTT
 
. : . : . : . : . : . :
JMFS107E01+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGCCTGCGTACAAATTCA
JMFS160F12+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGCCTGCGTACAAATTCA
JMFS058C08+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGCCTGCGTACAAATTCA
JMFS140C08+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMFS002A09+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGCCTGCGTACAAATTCA
JMFS089G01+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMFS105B01+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAG----------------
JMSF021G06+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMFS134B11+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMFS038D10+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMFS142C03+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMFS165H09+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMFS089G08+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMFS164G12+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMFS040E03+ CTCCA
JMSF019P21+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMSF014G01+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMFF011C07+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
JMSF021C01+ CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
                      ____________________________________________________________
consensus CTCCAATAACTGTATAGTAAAGCAGAGAGGATTCCTGAATTCAGC---AGTGTGAAGCCG
 
. : . : . : . : . : . :
JMFS107E01+ TACGCC
JMFS160F12+ TACGCC
JMFS058C08+ TACGCC
JMFS140C08+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGA
JMFS002A09+ TACGCC
JMFS089G01+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAG
JMFS105B01+ --CGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
JMSF021G06+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
JMFS134B11+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
JMFS038D10+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
JMFS142C03+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
JMFS165H09+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
JMFS089G08+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAG
JMFS164G12+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
JMSF019P21+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
JMSF014G01+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
JMFF011C07+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
JMSF021C01+ TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
                      ____________________________________________________________
consensus TACGGTGTTTTGGTGGGGGGGTGGGTGGGTGGATTGGGTTGAGGAGACGACAGCGGAAAA
 
. : . : . : . : . : . :
JMFS105B01+ AGCAGCGGTACA
JMSF021G06+ AGCAGCGGTACACCTAAACGCCGACGTCT
JMFS134B11+ AGCAGCGGT
JMFS038D10+ AGCAGCGGTA
JMFS142C03+ AGCAGCGGTACA
JMFS165H09+ AGCAGCGGTACACCTAAACGCCG
JMFS164G12+ AGCAGCGGTACACCTAAACGCCG
JMSF019P21+ AGCAGCGGTACACCTAAACGCCGACGTCT
JMSF014G01+ AGCAGCGGTACACCTAAACGCCGACGTCT
JMFF011C07+ AGCAGCGGTACACCTAAACGCCGACGTCT
JMSF021C01+ AGCAGCGGTACACCTAAACGCCGACGTCTCTATGAATTGTATCCATCCTACTCACTGTTC
                      ____________________________________________________________
consensus AGCAGCGGTACACCTAAACGCCGACGTCTCTATGAATTGTATCCATCCTACTCACTGTTC