Previous Contig 005944:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024G23Sequence516005944 (4)642021219
JMFS007H08Sequence592005944 (4)
JMSF021A09Sequence299005944 (4)255005944 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS007H08+ GCTGTCGCCT
                      ____________________________________________________________
consensus GCTGTCGCCT
 
. : . : . : . : . : . :
JMFS007H08+ TTCCCCCTGAATTTGAGCATCCATCTAAATAGGCAATAGAGATATATATAGATCTGAGAG
                      ____________________________________________________________
consensus TTCCCCCTGAATTTGAGCATCCATCTAAATAGGCAATAGAGATATATATAGATCTGAGAG
 
. : . : . : . : . : . :
JMFS007H08+ CTAAGCTGAATAATCTTTTCAAAAATGAAAAGCCAAGAGTGCCACAAAACAGCCATTAAA
JMFF024G23+ AAATGAAAAGCCAAGAGTGCCACAAAACAGCCATTAAA
                      ____________________________________________________________
consensus CTAAGCTGAATAATCTTTTCAAAAATGAAAAGCCAAGAGTGCCACAAAACAGCCATTAAA
 
. : . : . : . : . : . :
JMFS007H08+ ACATGCCTCATGACAACCTAACATTGTTAATCAATTGGCAATTAATCAATTGAAGTAAAT
JMFF024G23+ ACATGCCTCATGACAACCTAACATTGTTAATCAATTGGCAATTAATCAATTGAAGTAAAT
                      ____________________________________________________________
consensus ACATGCCTCATGACAACCTAACATTGTTAATCAATTGGCAATTAATCAATTGAAGTAAAT
 
. : . : . : . : . : . :
JMFS007H08+ CAATTGGCAGTTAATCAATTGAATTGAAGTAAATCAATTGGCAGTTAATCAGATGAGATC
JMFF024G23+ CAATTGGCAGTTAATCAATTGAATTGAAGTAAATCAATTGGCAGTTAATCAGATGAGATC
                      ____________________________________________________________
consensus CAATTGGCAGTTAATCAATTGAATTGAAGTAAATCAATTGGCAGTTAATCAGATGAGATC
 
. : . : . : . : . : . :
JMFS007H08+ ATCTGGTTAATCAATTGGCGTGACCAGATGATAAGCAATCAATCACATAAAAATATAAAG
JMFF024G23+ ATCTGGTTAATCAATTGGCGTGACCAGATGATAAGCAATCAATCACATAAAAATATAAAG
                      ____________________________________________________________
consensus ATCTGGTTAATCAATTGGCGTGACCAGATGATAAGCAATCAATCACATAAAAATATAAAG
 
. : . : . : . : . : . :
JMFS007H08+ CAACGAAAATGATAAATTTCAAAATATTTACGAAATATGTTAATATTTCATACA-GTTGC
JMFF024G23+ CAACGAAAATGATAAATTTCAAAATATTTACGAAATATGTTAATATTTCATACA-GTTGC
rJMSF021A09- TTTCATACAGGTTGC
JMSF021A09+ TGATAAATTTCAAAATATTTACGAAATATGTTAATATTTCATACA-GTTGC
                      ____________________________________________________________
consensus CAACGAAAATGATAAATTTCAAAATATTTACGAAATATGTTAATATTTCATACA-GTTGC
 
. : . : . : . : . : . :
JMFS007H08+ ATCAACCAGAAAAGTAAGAGACAAAAACAAGTAAAGGATAGAGGAGACTACCCATTAATA
JMFF024G23+ ATCAACCAGAAAAGTAAGAGACAAAAACAAGTAAAGGATAGAGGAGACTACCCATTAATA
rJMSF021A09- ATCAACCAGAAAAGTAAGAGACAAAAACAAGTAAAGGATAGAGGAGACTACCCATTAATA
JMSF021A09+ ATCAACCAGAAAAGTAAGAGACAAAAACAAGTAAAGGATAGAGGAGACTACCCATTAATA
                      ____________________________________________________________
consensus ATCAACCAGAAAAGTAAGAGACAAAAACAAGTAAAGGATAGAGGAGACTACCCATTAATA
 
. : . : . : . : . : . :
JMFS007H08+ CATCTACATGGATGCCTTTTCCACCGCCGCAACAAGACACCAACGCCGGAGGCAACACCA
JMFF024G23+ CATCTACATGGATGCCTTTTCCACCGCCGCAACAAGACACCAACGCCGGAGGCAACACCA
rJMSF021A09- CATCTACATGGATGCCTTTTCCACCGCCGCAACAAGACACCAACGCCGGAGGCAACACCA
JMSF021A09+ CATCTACATGGATGCCTTTTCCACCGCCGCAACAAGACACCAACGCCGGAGGCAACACCA
                      ____________________________________________________________
consensus CATCTACATGGATGCCTTTTCCACCGCCGCAACAAGACACCAACGCCGGAGGCAACACCA
 
. : . : . : . : . : . :
JMFS007H08+ CACCGCCTAGAGAGAAGTGGTTCGGGCGCAGCAACACCACATACCGCCAGATCTACCAGA
JMFF024G23+ CACCGCCTAGAGAGAAGTGGTTCGGGCGCAGCAACACCACATACCGCCAAATCTACCAGA
rJMSF021A09- CACCGCCTAGAGAGAAGTGGTTCGGGCGCAGCAACACCACATACCGCCAGATCTACCAGA
JMSF021A09+ CACCGCCTAGAGAGAAGTGGTTCGGGCGCAGCAACACCACATACCGCCAGATCTACCAGA
                      ____________________________________________________________
consensus CACCGCCTAGAGAGAAGTGGTTCGGGCGCAGCAACACCACATACCGCCAGATCTACCAGA
 
. : . : . : . : . : . :
JMFS007H08+ TGTGAAACGGTTCAGGACATCCAGATCTAGAGACTTTAGGAAA
JMFF024G23+ TGTGAAACGGTTCAGGACATCCAGATCTAGAGACTTTAGGAAAGACATCATCTGGTTAC
rJMSF021A09- TGTGAAACGGTTCAGGACATCCAGATCTAGAGACTTTAGGAAAGACATCATCTGGTTAC
JMSF021A09+ TGTGAAACGGTTCAGGACATCCAGATCTAGAGACTTTAGGAAAGACATCATCTGGTTACC
                      ____________________________________________________________
consensus TGTGAAACGGTTCAGGACATCCAGATCTAGAGACTTTAGGAAAGACATCATCTGGTTACC