Previous Contig 005942:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021A01Sequence650005942 (2)pir|D84693|D846933e-14hypothetical protein At2g29180 [imported] - Arabidopsis thaliana>gb:AC004561_153602005942 (2)pir|D84693|D846933e-14hypothetical protein At2g29180 [imported] - Arabidopsis thaliana>gb:AC004561_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021A01+ GGAGGGAGTGGCGGATGAGATGAGACATGGCTGTTTCGTGTCTATCTCTG
JMSF021A01- GGAGGGAGTGGCGGATGAGATGAGACATGGCTGTTTCGTGTCTATCTCTG
                      ____________________________________________________________
consensus GGAGGGAGTGGCGGATGAGATGAGACATGGCTGTTTCGTGTCTATCTCTG
 
. : . : . : . : . : . :
rJMSF021A01+ TTTCTCTCTCCACCGTCGTCGCCGCCGCCGCCGCCACTTAAAGAGCTTCAACCGTTCACC
JMSF021A01- TTTCTCTCTCCACCGTCGTCGCCGCCGCCGCCGCCACTTAAAGAGCTTCAACCGTTCACC
                      ____________________________________________________________
consensus TTTCTCTCTCCACCGTCGTCGCCGCCGCCGCCGCCACTTAAAGAGCTTCAACCGTTCACC
 
. : . : . : . : . : . :
rJMSF021A01+ GCCCACAGCTCTCGTCTCTCACTTCTCTTCCCGGTAACTTCACCATCCCAACTTTCCTCC
JMSF021A01- GCCCACAGCTCTCGTCTCTCACTTCTCTTCCCGGTAACTTCACCATCCCAACTTTCCTCC
                      ____________________________________________________________
consensus GCCCACAGCTCTCGTCTCTCACTTCTCTTCCCGGTAACTTCACCATCCCAACTTTCCTCC
 
. : . : . : . : . : . :
rJMSF021A01+ AAGAGGAGGATTTCCCATTCTCGCCGGAATGGAGGGAGAATCTCTGCTTTCCCGGAGAAT
JMSF021A01- AAGAGGAGGATTTCCCATTCTCGCCGGAATGGAGGGAGAATCTCTGCTTTCCCGGAGAAT
                      ____________________________________________________________
consensus AAGAGGAGGATTTCCCATTCTCGCCGGAATGGAGGGAGAATCTCTGCTTTCCCGGAGAAT
 
. : . : . : . : . : . :
rJMSF021A01+ TTCCTGCTCTCAGAAGCAGACGCGGTCCTGAATTCCCCGGAAATAGCTTCGACGGCCGAT
JMSF021A01- TTCCTGCTCTCAGAAGCAGACGCGGTCCTGAATTCCCCGGAAATAGCTTCGACGGCCGAT
                      ____________________________________________________________
consensus TTCCTGCTCTCAGAAGCAGACGCGGTCCTGAATTCCCCGGAAATAGCTTCGACGGCCGAT
 
. : . : . : . : . : . :
rJMSF021A01+ GGTGGAACGTCGTCCGTCATATCAACCCTGCTTTTGATTGCTTTCGCCGGCTTATCCGTT
JMSF021A01- GGTGGAACGTCGTCCGTCATATCAACCCTGCTTTTGATTGCTTTCGCCGGCTTATCCGTT
                      ____________________________________________________________
consensus GGTGGAACGTCGTCCGTCATATCAACCCTGCTTTTGATTGCTTTCGCCGGCTTATCCGTT
 
. : . : . : . : . : . :
rJMSF021A01+ CTCACTGTCGGGGTTATCTACATATCTGTAACAGATTACTTGCAGAAAAGGGAGAGTGAC
JMSF021A01- CTCACTGTCGGGGTTATCTACATATCTGTAACAGATTACTTGCAGAAAAGGGAGAGTGAC
                      ____________________________________________________________
consensus CTCACTGTCGGGGTTATCTACATATCTGTAACAGATTACTTGCAGAAAAGGGAGAGTGAC
 
. : . : . : . : . : . :
rJMSF021A01+ AAGTTTGAAAAAGAAGAGGCAGCTAAGAAGAAGAAGAAGAGTGGGAAAAAGGGGAAAGTT
JMSF021A01- AAGTTTGAAAAAGAAGAGGCAGCTAAGAAGAAGAAGAAGAGTGGGAAAAAGGGGAAAGTT
                      ____________________________________________________________
consensus AAGTTTGAAAAAGAAGAGGCAGCTAAGAAGAAGAAGAAGAGTGGGAAAAAGGGGAAAGTT
 
. : . : . : . : . : . :
rJMSF021A01+ GTAAGTAGAGCTAGAGCTGGACCAAGAGGCTTTGGGCAAAAGATTGTTGAAGAAGATGAT
JMSF021A01- GTAAGTAGAGCTAGAGCTGGACCAAGAGGCTTTGGGCAAAAGATTGTTGAAGAAGATGAT
                      ____________________________________________________________
consensus GTAAGTAGAGCTAGAGCTGGACCAAGAGGCTTTGGGCAAAAGATTGTTGAAGAAGATGAT
 
. : . : . : . : . : . :
rJMSF021A01+ GATTGATGTTATCAAATTGCAGCCTTTTTACATATGTTTATTCTTCTCTTTGGGCACTCT
JMSF021A01- GATTGATGTTATCAAATTGCAGCCTTTTTACATATGTTTATTCTTCTCTTTGGGCACTCT
                      ____________________________________________________________
consensus GATTGATGTTATCAAATTGCAGCCTTTTTACATATGTTTATTCTTCTCTTTGGGCACTCT
 
. : . : . : . : . : . :
rJMSF021A01+ TTTCCAATGTTC
JMSF021A01- TTTCCAATGTTCATTCCAATTCAATTCGGTTAATAAAAATACCAGATGTTATATTTNNNA
                      ____________________________________________________________
consensus TTTCCAATGTTCATTCCAATTCAATTCGGTTAATAAAAATACCAGATGTTATATTTNNNA