Previous Contig 005940:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009M15Sequence602005940 (10)gb:AY035067_15598401e-79Arabidopsis thaliana putative ATP citrate lyase (At5g49460) mRNA, complete cds.>727009505 (13)gb:AF290958_17836261e-82Capsicum annuum ATP:citrate lyase mRNA, complete cds.
JMFF029A24Sequence545005940 (10)gb:AF290958_17836261e-63Capsicum annuum ATP:citrate lyase mRNA, complete cds.686009505 (13)gb:AF290958_17836264e-84Capsicum annuum ATP:citrate lyase mRNA, complete cds.
JMFF033J10Sequence539005940 (10)gb:AF290958_17836263e-67Capsicum annuum ATP:citrate lyase mRNA, complete cds.731009505 (13)gb:AF290958_17836267e-83Capsicum annuum ATP:citrate lyase mRNA, complete cds.
JMSF018E15Sequence506005940 (10)gb:AF290958_17836264e-62Capsicum annuum ATP:citrate lyase mRNA, complete cds.753009505 (13)gb:AF290958_1783626e-100Capsicum annuum ATP:citrate lyase mRNA, complete cds.
JMSF019F07Sequence316005940 (10)gb:AF290958_17836262e-33Capsicum annuum ATP:citrate lyase mRNA, complete cds.
JMSF020P14Sequence652005940 (10)gb:AY035067_15598403e-89Arabidopsis thaliana putative ATP citrate lyase (At5g49460) mRNA, complete cds.>717009505 (13)gb:AF290958_1783626e-101Capsicum annuum ATP:citrate lyase mRNA, complete cds.
JMSF028C22Sequence660005940 (10)gb:AY035067_15598404e-92Arabidopsis thaliana putative ATP citrate lyase (At5g49460) mRNA, complete cds.>720009505 (13)gb:AF290958_17836262e-97Capsicum annuum ATP:citrate lyase mRNA, complete cds.
JMSF041L20Sequence782005940 (10)gb:AY035067_1559840e-116Arabidopsis thaliana putative ATP citrate lyase (At5g49460) mRNA, complete cds.>747009505 (13)gb:AF290958_17836262e-89Capsicum annuum ATP:citrate lyase mRNA, complete cds.
JMSF043M05Sequence821005940 (10)gb:AY035067_1559840e-114Arabidopsis thaliana putative ATP citrate lyase (At5g49460) mRNA, complete cds.>723009505 (13)gb:AF290958_17836262e-95Capsicum annuum ATP:citrate lyase mRNA, complete cds.
JMSF047C22Sequence692005940 (10)gb:AY035067_15598406e-97Arabidopsis thaliana putative ATP citrate lyase (At5g49460) mRNA, complete cds.>732009505 (13)gb:AF290958_17836262e-97Capsicum annuum ATP:citrate lyase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041L20+ AAGAATAACC
JMSF043M05+ AAGGAGTATTCATCCNTTCCACCGAGTTCCCCAAGAACAACC
                      ____________________________________________________________
consensus AAGGAGTATTCATCCNTTCCACCGAGTTCCCCAAGAATAACC
 
. : . : . : . : . : . :
JMSF041L20+ ATCATTTTAACCTGTGGAATATTGTTAAATCGCAGAACATGATCAGACAATGTTGAACCA
JMSF043M05+ ATCATTTTAACCTGTGGAATATTGTTAAATCGCAGAACATGATCAGACAATGTTGAACCA
                      ____________________________________________________________
consensus ATCATTTTAACCTGTGGAATATTGTTAAATCGCAGAACATGATCAGACAATGTTGAACCA
 
. : . : . : . : . : . :
JMSF041L20+ GGAAACACATCTCCTCCAATTGCAATACCTTCATAAATTCCATCTGTCACTCGGGCAATG
JMSF047C22+ CTTCATAAATTCCATCTGTCACTCGGGCAATG
JMSF028C22+ GGGCAATG
JMSF043M05+ GGAAACACATCTCCTCCAATTGCAATACCTTCATAAATTCCATCTGTCACTCGGGCAATG
                      ____________________________________________________________
consensus GGAAACACATCTCCTCCAATTGCAATACCTTCATAAATTCCATCTGTCACTCGGGCAATG
 
. : . : . : . : . : . :
JMSF041L20+ GTATTGTACAATTCATTAGACATACCACCTGATTTGGAGACAAATCCAACAGATCCAGGT
JMSF047C22+ GTATTGTACAATTCATTAGACATACCACCTGATTTGGAGACAAATCCAACAGATCCAGGT
JMSF028C22+ GTATTGTACAATTCATTAGACATACCACCTGATTTGGAGACAAATCCAACAGATCCAGGT
JMSF043M05+ GTATTGTACAATTCATTAGACATACCACCTGATTTGGAGACAAATCCAACAGATCCAGGT
JMFF009M15+ GGT
JMSF020P14+ CAATTCATTAGACATACCACCTGATTTGGAGACAAATCCAACAGATCCAGGT
                      ____________________________________________________________
consensus GTATTGTACAATTCATTAGACATACCACCTGATTTGGAGACAAATCCAACAGATCCAGGT
 
. : . : . : . : . : . :
JMSF041L20+ CTGTATAGCTTGCATTGAATAATGTTATCAATTGTTCCAGCAGTGTCACCAATTCTAAAA
JMSF047C22+ CTGTATAGCTTGCATTGAATAATGTTATCAATTGTTCCAGCAGTGTCACCAATTCTAAAA
JMSF028C22+ CTGTATAGCTTGCATTGAATAATGTTATCAATTGTTCCAGCAGTGTCACCAATTCTAAAA
JMSF043M05+ CTGTATAGCTTGCATTGAATAATGTTATCAATTGTTCCAGCAGTGTCACCAATTCTAAAA
JMFF009M15+ CTGTATAGCTTGCATTGAATAATGTTATCAATTGTTCCAGCAGTGTCACCAATTCTAAAA
JMSF020P14+ CTGTATAGCTTGCATTGAATAATGTTATCAATTGTTCCAGCAGTGTCACCAATTCTAAAA
                      ____________________________________________________________
consensus CTGTATAGCTTGCATTGAATAATGTTATCAATTGTTCCAGCAGTGTCACCAATTCTAAAA
 
. : . : . : . : . : . :
JMSF041L20+ GCACCAGCTTGAATTCCTCCAACGGTAGCTGGACCAACAACAACCTTGTTGTTTGCCTTT
JMSF047C22+ GCACCAGCTTGAATTCCTCCAACGGTAGCTGGACCAACAACAACCTTGTTGTTTGCCTTT
JMSF028C22+ GCACCAGCTTGAATTCCTCCAACGGTAGCTGGACCAACAACAACCTTGTTGTTTGCCTTT
JMSF018E15+ AGCTGGACCAACAACANCCTTGTTGTTTGCCTTT
JMSF043M05+ GCACCAGCTTGAATTCCTCCAACGGTAGCTGGACCAACAACAACCTTGTTGTTTGCCTTT
JMFF009M15+ GCACCAGCTTGAATTCCTCCAACGGTAGCTGGACCAACAACAACCTTGTTGTTTGCCTTT
JMFF029A24+ AACGGTAGCTGGACCAACAACAACCTTGTTGTTTGCCTTT
JMFF033J10+ GCACCAGCTTGAATTCCTCCAACGGTAGCTGGACCAACAACAACCTTGTTGTTTGCCTTT
JMSF020P14+ GCACCAGCTTGAATTCCTCCAACGGTAGCTGGACCAACAACAACCTTGTTGTTTGCCTTT
                      ____________________________________________________________
consensus GCACCAGCTTGAATTCCTCCAACGGTAGCTGGACCAACAACAACCTTGTTGTTTGCCTTT
 
. : . : . : . : . : . :
JMSF041L20+ GCATAAGCAATCAATTGCTTGGTGTCCGACTCTGGAACACCTTCAGCTATAATAGCCACA
JMSF047C22+ GCATAAGCAATCAATTGCTTGGTGTCCGACTCTGGAACACCTTCAGCTATAATAGCCACA
JMSF028C22+ GCATAAGCAATCAATTGCTTGGTGTCCGACTCTGGAACACCTTCAGCTATAATAGCCACA
JMSF018E15+ GCATAAGCAATCAATTGCTTGGTGTCCGACTCTGGAACACCTTCAGCTATAATAGCCACA
JMSF043M05+ GCATAAGCAATCAATTGCTTGGTGTCCGACTCTGGAACACCTTCAGCTATAATAGCCACA
JMFF009M15+ GCATAAGCAATCAATTGCTTGGTGTCCGACTCTGGAACACCTTCAGCTATAATAGCCACA
JMFF029A24+ GCATAAGCAATCAATTGCTTGGTGTCCGACTCTGGAACACCTTCAGCTATAATAGCCACA
JMFF033J10+ GCATAAGCAATCAATTGCTTGGTGTCCGACTCTGGAACACCTTCAGCTATAATAGCCACA
JMSF020P14+ GCATAAGCAATCAATTGCTTGGTGTCCGACTCTGGAACACCTTCAGCTATAATAGCCACA
                      ____________________________________________________________
consensus GCATAAGCAATCAATTGCTTGGTGTCCGACTCTGGAACACCTTCAGCTATAATAGCCACA
 
. : . : . : . : . : . :
JMSF041L20+ ACTCTAATGGTTGGTTGTTTGAGAGCAGCCATGGAGGAAGCAGCGGCACTTCTAAATGAT
JMSF047C22+ ACTCTAATGGTTGGTTGTTTGAGAGCAGCCATGGAGGAAGCAGCGGCACTTCTAAATGAT
JMSF028C22+ ACTCTAATGGTTGGTTGTTTGAGAGCAGCCATGGAGGAAGCAGCGGCACTTCTAAATGAT
JMSF018E15+ ACTCTAATGGTTGGTTGTTTGAGAGCAGCCATGGAGGAAGCAGCGGCACTTCTAAATGAT
JMSF043M05+ ACTCTAATGGTTGGTTGTTTGAGAGCAGCCATGGAGGAAGCAGCGGCACTTCTAAATGAT
JMFF009M15+ ACTCTAATGGTTGGTTGTTTGAGAGCAGCCATGGAGGAAGCAGCGGCACTTCTAAATGAT
JMFF029A24+ ACTCTAATGGTTGGTTGTTTGAGAGCAGCCATGGAGGAAGCAGCGGCACTTCTAAATGAT
JMFF033J10+ ACTCTAATGGTTGGTTGTTTGAGAGCAGCCATGGAGGAAGCAGCGGCACTTCTAAATGAT
JMSF020P14+ ACTCTAATGGTTGGTTGTTTGAGAGCAGCCATGGAGGAAGCAGCGGCACTTCTAAATGAT
                      ____________________________________________________________
consensus ACTCTAATGGTTGGTTGTTTGAGAGCAGCCATGGAGGAAGCAGCGGCACTTCTAAATGAT
 
. : . : . : . : . : . :
JMSF041L20+ GCAAAGTTAATGAAAACATCAGCTGTGGGGTGAGCAGCACAAGCGGCGTCAATGGCTGAA
JMSF047C22+ GCAAAGTTAATGAAAACATCAGCTGTGGGGTGAGCAGCACAAGCGGCGTCAATGGCTGAA
JMSF028C22+ GCAAAGTTAATGAAAACATCAGCTGTGGGGTGAGCAGCACAAGCGGCGTCAATGGCTGAA
JMSF018E15+ GCAAAGTTAATGAAAACATCAGCTGTGGGGTGAGCAGCACAAGCGGCGTCAATGGCTGAA
JMSF043M05+ GCAAAGTTAATGAAAACATCAGCTGTGGGGTGAGCAGCACAAGCGGCGTCAATGGCTGAA
JMFF009M15+ GCAAAGTTAATGAAAACATCAGCTGTGGGGTGAGCAGCACAAGCGGCGTCAATGGCTGAA
JMFF029A24+ GCAAAGTTAATGAAAACATCAGCTGTGGGGTGAGCAGCACAAGCGGCGTCAATGGCTGAA
JMSF019F07+ GGCGTCAATGGCTGAA
JMFF033J10+ GCAAAGTTAATGAAAACATCAGCTGTGGGGTGAGCAGCACAAGCGGCGTCAATGGCTGAA
JMSF020P14+ GCAAAGTTAATGAAAACATCAGCTGTGGGGTGAGCAGCACAAGCGGCGTCAATGGCTGAA
                      ____________________________________________________________
consensus GCAAAGTTAATGAAAACATCAGCTGTGGGGTGAGCAGCACAAGCGGCGTCAATGGCTGAA
 
. : . : . : . : . : . :
JMSF041L20+ TGCACTGGGATTGCGATCTCCTCCTGACCGAAGAAGAGCTTTTGGAATCCCTCTGAACCA
JMSF047C22+ TGCACTGGGATTGCGATCTCCTCCTGACCGAAGAAGAGCTTTTGGAATCCCTCTGAACCA
JMSF028C22+ TGCACTGGGATTGCGATCTCCTCCTGACCGAAGAAGAGCTTTTGGAATCCCTCTGAACCA
JMSF018E15+ TGCACTGGGATTGCGATCTCCTCCTGACCGAAGAAGAGCTTTTGGAATCCCTCTGAACCA
JMSF043M05+ CGCACTGGGATTGCGATCTCCTCCTGACCGAAGAAGAGCTTTTGGAATCCCTCTGAACCA
JMFF009M15+ TGCACTGGGATTGCGATCTCCTCCTGACCGAAGAAGAGCTTTTGGAATCCCTCTGAACCA
JMFF029A24+ TGCACTGGGATTGCGATCTCCTCCTGACCGAAGAAGAGCTTTTGGAATCCCTCTGAACCA
JMSF019F07+ TGCACTGGGATTGCGATCTCCTCCTGACCGAAGAAGAGCTTTTGGAATCCCTCTGAACCA
JMFF033J10+ TGCACTGGGATTGCGATCTCCTCCTGACCGAAGAAGAGCTTTTGGAATCCCTCTGAACCA
JMSF020P14+ TGCACTGGGATTGCGATCTCCTCCTGACCGAAGAAGAGCTTTTGGAATCCCTCTGAACCA
                      ____________________________________________________________
consensus TGCACTGGGATTGCGATCTCCTCCTGACCGAAGAAGAGCTTTTGGAATCCCTCTGAACCA
 
. : . : . : . : . : . :
JMSF041L20+ GGGTTTACAATTCCAGCAACAGAAGGTGTTTCTCTCCCACAAAGGAAATCGAAATCAAGC
JMSF047C22+ GGGTTTACAATTCCAGCAACAGAAGGTGTTTCTCTCCCACAAAGGAAATCGAAATCAAGC
JMSF028C22+ GGGTTTACAATTCCAGCAACAGAAGGTGTTTCTCTCCCACAAAGGAAATCGAAATCAAGC
JMSF018E15+ GGGTTTACAATTCCAGCAACAGAAGGTGTTTCTCTCCCACAAAGGAAATCGAAATCAAGC
JMSF043M05+ GGGTTTACAATTCCAGCAACAGAAGGTGTTTCTCTCCCACAAAGGAAATCGAAAT-AAGC
JMFF009M15+ GGGTTTACAATTCCAGCAACAGAAGGTGTTTCTCTCCCACAAAGGAAATCGAAATCAAGC
JMFF029A24+ GGGTTTACAATTCCAGCAACAGAAGGTGTTTCTCTCCCACAAAGGAAATCGAAATCAAGC
JMSF019F07+ GGGTTTACAATTCCAGCAACAGAAGGTGTTTCTCTCCCACAAAGGAAATCGAAATCAAGC
JMFF033J10+ GGGTTTACAATTCCAGCAACAGAAGGTGTTTCTCTCCCACAAAGGAAATCGAAATCAAGC
JMSF020P14+ GGGTTTACAATTCCAGCAACAGAAGGTGTTTCTCTCCCACAAAGGAAATCGAAATCAAGC
                      ____________________________________________________________
consensus GGGTTTACAATTCCAGCAACAGAAGGTGTTTCTCTCCCACAAAGGAAATCGAAATCAAGC
 
. : . : . : . : . : . :
JMSF041L20+ ATCCGTTGGATGGGAAGTTGCTTGTAGTTGTAGAACAAAGCTTGAGTGGTCTTGGAAAAA
JMSF047C22+ ATCCGTTGGATGGGAAGTTGCTTGTAGTTGTAGAACAAAGCTTGAGTGGTCTTGGAAAAA
JMSF028C22+ ATCCGTTGGATGGGAAGTTGCTTGTAGTTGTAGAACAAAGCTTGAGTGGTCTTGGAAAAA
JMSF018E15+ ATCCGTTGGATGGGAAGTTGCTTGTAGTTGTAGAACAAAGCTTGAGTGGTCTTGGAAAAA
JMSF043M05+ ATCCGTTGGATGGGAAGTTGCTTGTAGTTGTAGAACAAAGCTTGAGTGGTCTTGGAAAAA
JMFF009M15+ ATCCGTTGGATGGGAAGTTGCTTGTAGTTGTAGAACAAAGCTTGAGTGGTCTTGGAAAAA
JMFF029A24+ ATCCGTTGGATGGGAAGTTGCTTGTAGTTGTAGAACAAAGCTTGAGTGGTCTTGGAAAAA
JMSF019F07+ ATCCGTTGGATGGGAAGTTGCTTGTAGTTGTAGAACAAAGCTTGAGTGGTCTTGGAAAAA
JMFF033J10+ ATCCGTTGGATGGGAAGTTGCTTGTAGTTGTAGAACAAAGCTTGAGTGGTCTTGGAAAAA
JMSF020P14+ ATCCGTTGGATGGGAAGTTGCTTGTAGTTGTAGAACAAAGCTTGAGTGGTCTTGGAAAAA
                      ____________________________________________________________
consensus ATCCGTTGGATGGGAAGTTGCTTGTAGTTGTAGAACAAAGCTTGAGTGGTCTTGGAAAAA
 
. : . : . : . : . : . :
JMSF041L20+ AGTTGCCCAGTTGCCATGGTGTCCAATCAATTCACAACTGAGCTTGGTAGGTTGTGCGAG
JMSF047C22+ AGTTGCCCAGTTGCCATGGTGTCCAATCAATTCACAACTGAGCTTGGTAGGTTGTGCGAG
JMSF028C22+ AGTTGCCCAGTTGCCATGGTGTCCAATCAATTCACAACTGAGCTTGGTAGGTTGTGCGAG
JMSF018E15+ AGTTGCCCAGTTGCCATGGTGTCCAATCAATTCACAACTGAGCTTGGTAGGTTGTGCGAG
JMSF043M05+ AGTTGCCCAGTTGCCATGGTGTCCAATCAATTCACAACTGAGCTTGGTAGGTTGTGCGAG
JMFF009M15+ AGTTGCCCAGTAGCCATGGTGTCCAATCAATTCACAACTGAGCTTGGTAGGTTGTGCGAG
JMFF029A24+ AGTTGCCCAGTTGCCATGGTGTCCAATCAATTCACAACTGAGCTT
JMSF019F07+ AGTTGCCCAGTTGCCATGGTGTCCAATCAATTCACAACTGAGCTTGGTAGGTTGTGCGAG
JMFF033J10+ AGTTGCCCAGTTGCCATGGTGTCCAATCAATTCACAACTGAGCTTGGTAGGTTGTGCGAG
JMSF020P14+ AGTTGCCCAGTTGCCATGGTGTCCAATCAATTCACAACTGAGCTTGGTAGGTTGTGCGAG
                      ____________________________________________________________
consensus AGTTGCCCAGTTGCCATGGTGTCCAATCAATTCACAACTGAGCTTGGTAGGTTGTGCGAG
 
. : . : . : . : . : . :
JMSF041L20+ ATCAAAGGAGTCGCCTCGTAAGCTCAGACGAGGTGTGTGAGAGAGACCGGTC
JMSF047C22+ ATCAAAGGAGTCGCCTCGTAAGCTCAGACGAGGTGTGTGAGAGAGACCGGTGGAGACA
JMSF028C22+ ATCAAAGGAGTCGCCTCGTAAGCTCAGACGAGGTGTGTGAGAGAGACCGGTC
JMSF018E15+ ATCAAAGGAGTCGCCTCGTAAGCTCAGACGAGGTGTGTGAGAGAGACCGGTC
JMSF043M05+ ATCAAAGGAGTCGCCTCGTAAGCTCAGACGAGGTGTGTGAGAGAGACCGGTGGAGACAC
JMFF009M15+ ATCAAAGGAGTCGCCTCGTAAGCTCAGACGAGGTGTGTGAGAGAGACCGGTGGAGACAC
JMSF019F07+ ATCAAAGGAGTCGCCTCGTAAGCTCAGACGAGGTGTGTGAGAGAGACCGGTGGAGAC
JMFF033J10+ ATCAAAGGAGTCGCCTCGTAAGCTCAGACGAGGTGTGTGAGAGAGACCGGTGGAGACAC
JMSF020P14+ ATCAAAGGAGTCGCCTCGTAAGCTCAGACGAGGTGTGTGAGAGAGACCGGTGGAGACACC
                      ____________________________________________________________
consensus ATCAAAGGAGTCGCCTCGTAAGCTCAGACGAGGTGTGTGAGAGAGACCGGTGGAGACACC