Previous Contig 005934:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010E21Sequence615005934 (15)gb:AK117132_18151799e-15Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA650002540 (8)pir|T47609|T476097e-06hypothetical protein T14E10.70 - Arabidopsis thaliana>gb:ATT14E10_1554465 Arabid
JMFS005C01Sequence504005934 (15)gb:AK117132_18151792e-05Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMFS008D08Sequence621005934 (15)gb:AK117132_18151794e-15Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMFS017A09Sequence616005934 (15)gb:AK117132_18151794e-15Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMFS025C06Sequence626005934 (15)gb:AK117132_18151793e-15Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMFS055F08Sequence627005934 (15)gb:AK117132_18151794e-14Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMFS073F06Sequence627005934 (15)gb:AK117132_18151793e-15Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMFS073H03Sequence634005934 (15)gb:AK117132_18151793e-15Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMFS078D02Sequence627005934 (15)gb:AK117132_18151797e-15Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMFS101F06Sequence617005934 (15)gb:AK117132_18151793e-14Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMFS115G01Sequence562005934 (15)gb:AK117132_18151792e-14Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMFS122F07Sequence576005934 (15)gb:AK117132_18151795e-08Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMFS149A05Sequence636005934 (15)gb:AK117132_18151791e-15Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA
JMSF012D20Sequence519005934 (15)gb:AK117132_18151794e-08Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA744002540 (8)pir|T47609|T476091e-05hypothetical protein T14E10.70 - Arabidopsis thaliana>gb:ATT14E10_1554465 Arabid
JMSF020O21Sequence673005934 (15)gb:AK117132_18151791e-14Arabidopsis thaliana At3g54500 mRNA for unknown protein, complete cds, clone: RA800002540 (8)pir|T47609|T476092e-21hypothetical protein T14E10.70 - Arabidopsis thaliana>gb:ATT14E10_1554465 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS149A05+ CTGCTTTTGAAAAATCTCAG
                      ____________________________________________________________
consensus CTGCTTTTGAAAAATCTCAG
 
. : . : . : . : . : . :
JMFS149A05+ AATTGATTCCTGGTTGAGCTGTCCCATCTTCATGTTTGGAAATTTCTGTTACATCATTAG
JMFS078D02+ AATTGATTCCTGGTTGAGCTGTCCCATCTTCATGTTTGGAAATNTCTGTTACATCATTAG
JMFS073F06+ AATTGATTCCTGGTTGAGCTGTCCCATCTTCATGTTTGGAAATTTCTGTTACATCATTAG
JMFS025C06+ AATTGATTCCTGGTTGAGCTGTCCCATCTTCATGTTTGGAAATTTCTGTTACATCATTAG
JMFS073H03+ AATTGATTCCTGGTTGAGCTGTCCCATCTTCATGTTTGGAAATTTCTGTTACATCATTAG
JMFS017A09+ TCATGTTTGGAAATTTCTGTTACATCATTAG
JMFS008D08+ TTGGAAATTTCTGTTACATCATTAG
JMFF010E21+ TACATCATTAG
JMSF020O21+ TGTTACATCATTAG
                      ____________________________________________________________
consensus AATTGATTCCTGGTTGAGCTGTCCCATCTTCATGTTTGGAAATTTCTGTTACATCATTAG
 
. : . : . : . : . : . :
JMFS149A05+ TTGTTTCTTTGCATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
JMFS078D02+ TTGTTTCTNTGCATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
JMFS073F06+ TTGTTTCTNTGCATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
JMFS025C06+ TTGTTTCTTTGCATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
JMFS073H03+ TTGTTTCTTTGCATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
JMFS017A09+ TTGTTTCTTTGCATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
JMFS008D08+ TTGTTTCTTTGCATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
JMFS055F08+ CTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
JMFS101F06+ CTTTGCATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
JMFS115G01+ CATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
JMFF010E21+ TTGTTTCTTTGCATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
JMSF020O21+ TTGTTTCTTTGCATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
                      ____________________________________________________________
consensus TTGTTTCTTTGCATGAGGAACCTTGATCCATTTTCGTAGTGTTTGATAAGGATAGGTCGG
 
. : . : . : . : . : . :
JMFS149A05+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMFS078D02+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMFS073F06+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMFS025C06+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMFS073H03+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMFS017A09+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMFS008D08+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMFS122F07+ CCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMFS055F08+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMFS101F06+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMFS115G01+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMFF010E21+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
JMSF012D20+ GCAGGAAGAGCTTCATCCGTTGCATGTTGGGAGC
JMSF020O21+ GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
                      ____________________________________________________________
consensus GCCACAAGTCCTTACCAAATGCCAGCGCAGGAAGAGCTTCATCCGTTGCATGTTTGGAGC
 
. : . : . : . : . : . :
JMFS149A05+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFS078D02+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFS073F06+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFS025C06+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFS073H03+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFS017A09+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFS008D08+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFS122F07+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFS005C01+ ATCAAAACCANCTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFS055F08+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFS101F06+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFS115G01+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMFF010E21+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMSF012D20+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
JMSF020O21+ TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
                      ____________________________________________________________
consensus TGCTTTCTAACTTAATATCAAAACCA-CTTTTGGGTGCAGGTTTCTTCTGATCACCCAGC
 
. : . : . : . : . : . :
JMFS149A05+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFS078D02+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFS073F06+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFS025C06+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFS073H03+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFS017A09+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFS008D08+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFS122F07+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFS005C01+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFS055F08+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFS101F06+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFS115G01+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMFF010E21+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMSF012D20+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
JMSF020O21+ TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
                      ____________________________________________________________
consensus TTAACATTTGAAGCTTCAAGATCCCATTCCTCCTTGACACTATCCCTGTGTGAAGCTGGA
 
. : . : . : . : . : . :
JMFS149A05+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFS078D02+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFS073F06+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFS025C06+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFS073H03+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFS017A09+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFS008D08+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFS122F07+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFS005C01+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFS055F08+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFS101F06+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFS115G01+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMFF010E21+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMSF012D20+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
JMSF020O21+ GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
                      ____________________________________________________________
consensus GGTTTTCCATCACTTTCATCTGGATATGGAACTATATGATCATCACTTTCCCCAGTCTCA
 
. : . : . : . : . : . :
JMFS149A05+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFS078D02+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFS073F06+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFS025C06+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFS073H03+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFS017A09+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFS008D08+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFS122F07+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFS005C01+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFS055F08+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFS101F06+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFS115G01+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMFF010E21+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMSF012D20+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
JMSF020O21+ CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
                      ____________________________________________________________
consensus CCCCATATTATGTTTGTTAACTCTTCGTCGTTCCAATCAAACATAGCTGAAAAAGAAAAA
 
. : . : . : . : . : . :
JMFS149A05+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFS078D02+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFS073F06+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFS025C06+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFS073H03+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFS017A09+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFS008D08+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFS122F07+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFS005C01+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFS055F08+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFS101F06+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFS115G01+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMFF010E21+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMSF012D20+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
JMSF020O21+ AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
                      ____________________________________________________________
consensus AGGAAAAAAATTCCAACTCCAAAGCGACGGTCTCCGACGTAACGCTCCGGAATTAGCCTA
 
. : . : . : . : . : . :
JMFS149A05+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFS078D02+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFS073F06+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFS025C06+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFS073H03+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFS017A09+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFS008D08+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFS122F07+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFS005C01+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFS055F08+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFS101F06+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFS115G01+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMFF010E21+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMSF012D20+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
JMSF020O21+ AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
                      ____________________________________________________________
consensus AGCATCGCCAAATCGCGGCTGCTCAGGTCACTCCAGATACGACTCCGCTTGACTGCATCG
 
. : . : . : . : . : . :
JMFS149A05+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFS078D02+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFS073F06+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFS025C06+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFS073H03+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFS017A09+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFS008D08+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFS122F07+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFS005C01+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFS055F08+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFS101F06+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFS115G01+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMFF010E21+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMSF012D20+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
JMSF020O21+ ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
                      ____________________________________________________________
consensus ATTCCTCCGGGATTTTACAGCAGACAATTACGGTAATTTTTCCGATAACTGAGCTCGCCG
 
. : . : . : . : . : . :
JMFS149A05+ GGGATTTAGCCTGCAGA
JMFS078D02+ GGGATTTAGCCTGCAGAGCAGAGGG
JMFS073F06+ GGGATTTAGCCTGCAGAGCAGAGGG
JMFS025C06+ GGGATTTAGCCTGCAGAGCAGAGGGCT
JMFS073H03+ GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGA
JMFS017A09+ GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGAGGGGGCGACACA
JMFS008D08+ GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGAGGGGGCGACACAGAGTAGAGAGA
JMFS122F07+ GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGAGGGGGCGACACAGAGTAGAGAGAGAA
JMFS005C01+ GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGAGGGGGCGACACAGAGTAGAGAGAGAA
JMFS055F08+ GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGAGGGGGCGACACAGAGTAGAGAGAGAA
JMFS101F06+ GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGAGGGGGCGACACAGAGTAGAGAGAGAA
JMFS115G01+ GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGA
JMFF010E21+ GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGAGGGGGCGACACAGAGTAGAGAGAGAA
JMSF012D20+ GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGAGGGGGCGACACAGAGTAGAGAGAGAA
JMSF020O21+ GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGAGGGGGCGACACAGAGTAGAGAGAGAA
                      ____________________________________________________________
consensus GGGATTTAGCCTGCAGAGCAGAGGGCTTTTCGGAGGGGGCGACACAGAGTAGAGAGAGAA
 
. : . : . : . : . : . :
JMFS122F07+ ATTGTAGAGAGAGAAACAAAGGGAGGGGACTTTGGGAGGA
JMFS005C01+ ATTGTAGAGAGAGAAACAAAGGGAGGGGACTTTGGGAGGA
JMFS055F08+ ATTGTAGAGAGAGAAACAAAGGGAGGGGACTTTGGGAGGAATGGTT
JMFS101F06+ ATTGTAGAGAGAGAAACAAAGGGA
JMFF010E21+ ATTGT
JMSF012D20+ ATTGT
JMSF020O21+ ATTGTAGAGAGAGAAACAAAGGGAGGGGACTTTGGGAGGAATGGTTTGAGAGTGGGCGTC
                      ____________________________________________________________
consensus ATTGTAGAGAGAGAAACAAAGGGAGGGGACTTTGGGAGGAATGGTTTGAGAGTGGGCGTC