Previous Contig 005933:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049D10Sequence633005933 (2)200012161 (2)
JMSF020O17Sequence609005933 (2)734012161 (2)gb:AC006068_15333611e-26Arabidopsis thaliana chromosome 2 clone T20F21 map ve016, complete sequence.>gb:

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049D10+ AGTA
                      ____________________________________________________________
consensus AGTA
 
. : . : . : . : . : . :
JMFF049D10+ AAGTTGGATAAAAGAGAGCTCGAGCCCCGGCTCCAACCAACACCCTTTTCACATCTGAAC
JMSF020O17+ TGAAC
                      ____________________________________________________________
consensus AAGTTGGATAAAAGAGAGCTCGAGCCCCGGCTCCAACCAACACCCTTTTCACATCTGAAC
 
. : . : . : . : . : . :
JMFF049D10+ ATGGCTCCTCCTCCTCACTCCCTGTTTCCCCCTCCTTCAGTTCCTCAATATACATAATTT
JMSF020O17+ ATGGNTCCTCCTCCTCACTCCCTGTTTNCCCCTCCTTCAGTTCCTCAATATACATAATTT
                      ____________________________________________________________
consensus ATGGCTCCTCCTCCTCACTCCCTGTTTCCCCCTCCTTCAGTTCCTCAATATACATAATTT
 
. : . : . : . : . : . :
JMFF049D10+ CTACCCCTAACAAAGTTCAGAAACAGTCACAATTCACCTACAAGCTCAAATTGAATCGAT
JMSF020O17+ CTACCCCTAACAAAGTTCAGAAACNGTCACAATTCNCCTACAAGNTCAAATTGAATCGNT
                      ____________________________________________________________
consensus CTACCCCTAACAAAGTTCAGAAACAGTCACAATTCACCTACAAGCTCAAATTGAATCGAT
 
. : . : . : . : . : . :
JMFF049D10+ TAATGAACTGCAATTCCAATAAACTAATGAATTAAAATCCCAAAACTGCAAAATTAAATC
JMSF020O17+ TAATGAACTGCAATTCCNATAAACTAATGAATTAAAATCCCNAAACTGCAAAATTAAATC
                      ____________________________________________________________
consensus TAATGAACTGCAATTCCAATAAACTAATGAATTAAAATCCCAAAACTGCAAAATTAAATC
 
. : . : . : . : . : . :
JMFF049D10+ CACAAACAAGCATTCAAATCAAACCCTAACCCTAACCCTAACCCTAACCCAAATGAACTT
JMSF020O17+ CNCAAACNAGCNTTCAAATCAAACCCTAACCCTAACCCTAACCCTAACCCAAATGAACTT
                      ____________________________________________________________
consensus CACAAACAAGCATTCAAATCAAACCCTAACCCTAACCCTAACCCTAACCCAAATGAACTT
 
. : . : . : . : . : . :
JMFF049D10+ TGCAAATAACAATCTTCACAATCCAGCTACTTCTTCAAACGAATTCGACCCAGAACAACA
JMSF020O17+ TGCAAATAACAATTTTCNCAATCCAGNTACTTTTTCAAACGAATTNGNCCCNGAACAACN
                      ____________________________________________________________
consensus TGCAAATAACAATTTTCACAATCCAGCTACTTTTTCAAACGAATTCGACCCAGAACAACA
 
. : . : . : . : . : . :
JMFF049D10+ CCTTCTCCGATTCCTACAGCAAAACAAAAAAAACCCAAACTTTTATTTCACTTCAAGAAC
JMSF020O17+ CCTTTTNCGNTTCCTNCAGCAAAACAAAAAAAACCCNAACTTTTATTTCNCTTCAAGAAC
                      ____________________________________________________________
consensus CCTTTTCCGATTCCTACAGCAAAACAAAAAAAACCCAAACTTTTATTTCACTTCAAGAAC
 
. : . : . : . : . : . :
JMFF049D10+ AAGAATGCAGGTTTTCTTGATCACGTTTCGCAATCTAAACCCCCACATGGGAGAGGGGAA
JMSF020O17+ AAGAATGCNGGTTTTNTTGATCNCGTTTCGCAATNTAAACCCCCNCNTGGGNGAGGGGAA
                      ____________________________________________________________
consensus AAGAATGCAGGTTTTCTTGATCACGTTTCGCAATCTAAACCCCCACATGGGAGAGGGGAA
 
. : . : . : . : . : . :
JMFF049D10+ CTGGGGAAGTTGATGAAAGGAAGCAAATTTAGAAAGCCCGGAATTCAATGAATTGTGATG
JMSF020O17+ CTGGGGAAGTTGATGAAAGGAAGCAAATTTAGAAAGCCCGGAATTCAATGAATTGTGATG
                      ____________________________________________________________
consensus CTGGGGAAGTTGATGAAAGGAAGCAAATTTAGAAAGCCCGGAATTCAATGAATTGTGATG
 
. : . : . : . : . : . :
JMFF049D10+ AGAGAGGGAAGCGGTACGGGACAAGAAAATCAACGACGAAAAAAAAAAGAGGTTTTTGTC
JMSF020O17+ AGAGAGGGAAGCGGTNCGGGACNAGAAAATCAACGNCGNAAAAAAAAAGAGGTTTTTGTC
                      ____________________________________________________________
consensus AGAGAGGGAAGCGGTACGGGACAAGAAAATCAACGACGAAAAAAAAAAGAGGTTTTTGTC
 
. : . : . : . : . : . :
JMFF049D10+ TATGTAATACAGCGGTTT
JMSF020O17+ TATGTAATACAGCGGTTTAGAAAGGAACGAGGCTATTCTGGGGTTGTCGGGCAATTCTTT
                      ____________________________________________________________
consensus TATGTAATACAGCGGTTTAGAAAGGAACGAGGCTATTCTGGGGTTGTCGGGCAATTCTTT