Previous Contig 005930:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003A19Sequence342005930 (16)sp|P51819|HS83_PHANI8e-33Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMFF003G05Sequence579005930 (16)sp|P51819|HS83_PHANI4e-81Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 677010596 (17)sp|P51819|HS83_PHANI1e-65Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMFF005G01Sequence526005930 (16)sp|P51819|HS83_PHANI2e-64Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 715010596 (17)sp|P51819|HS83_PHANI2e-70Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMFF022B11Sequence582005930 (16)sp|P51819|HS83_PHANI4e-81Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 782010596 (17)sp|P51819|HS83_PHANI9e-84Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMFF022D19Sequence451005930 (16)sp|P51819|HS83_PHANI4e-55Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 747010596 (17)sp|P51819|HS83_PHANI2e-75Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMFF024C07Sequence490005930 (16)sp|P51819|HS83_PHANI2e-61Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 711010596 (17)sp|P51819|HS83_PHANI6e-70Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMFF030O06Sequence539005930 (16)sp|P51819|HS83_PHANI4e-69Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 686010596 (17)sp|P51819|HS83_PHANI8e-77Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMFF032O17Sequence544005930 (16)sp|P51819|HS83_PHANI3e-70Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMFF033E05Sequence518005930 (16)sp|P51819|HS83_PHANI3e-68Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 748010596 (17)sp|P51819|HS83_PHANI3e-90Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMFF039P24Sequence525005930 (16)sp|P51819|HS83_PHANI6e-68Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 504010596 (17)sp|P51819|HS83_PHANI2e-44Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMFF042L10Sequence627005930 (16)sp|P51819|HS83_PHANI1e-88Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 643010596 (17)sp|P51819|HS83_PHANI3e-50Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMFF045O21Sequence641005930 (16)sp|P51819|HS83_PHANI5e-80Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 658010596 (17)sp|P51819|HS83_PHANI1e-61Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMSF015F12Sequence520005930 (16)sp|P51819|HS83_PHANI3e-68Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 762010596 (17)sp|P51819|HS83_PHANI2e-85Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMSF020O04Sequence723005930 (16)sp|P51819|HS83_PHANI7e-80Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 739010596 (17)sp|P51819|HS83_PHANI1e-81Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMSF040E02Sequence637005930 (16)sp|P51819|HS83_PHANI3e-92Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 845010596 (17)sp|P51819|HS83_PHANIe-101Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83
JMSF047P08Sequence640005930 (16)sp|P51819|HS83_PHANI5e-93Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83 756010596 (17)sp|P51819|HS83_PHANI2e-84Heat shock protein 83.>gb:PHNHSP83A_1700143 Pharbitis nil heat shock protein 83

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047P08+ TCCTCTGCC
JMSF040E02+ TCTGCC
                      ____________________________________________________________
consensus TCCTCTGCC
 
. : . : . : . : . : . :
JMSF047P08+ CAGTTGCTCTCCATCCACATCCCTAGTGACAGTGAATGAACCACCAGCTTGTGATTCCCA
JMSF040E02+ CAGTTGCTCTCCATCCACATCCCTAGTGACAGTGAATGAACCACCAGCTTGTGATTCCCA
JMFF022B11+ TGATTCCCA
JMFF003G05+ TGATTCCCA
JMFF042L10+ ACAGTGAATGAACCACCAGCTTGTGATTCCCA
JMFF045O21+ GATTCCCA
JMSF020O04+ TCCCA
                      ____________________________________________________________
consensus CAGTTGCTCTCCATCCACATCCCTAGTGACAGTGAATGAACCACCAGCTTGTGATTCCCA
 
. : . : . : . : . : . :
JMSF047P08+ GATGTACTGTTCGTCATCATTGTGTTTGGTGGTCACAATGACCTTCTCTGCAACAAGGTA
JMSF040E02+ GATGTACTGTTCGTCATCATTGTGTTTGGTGGTCACAATGACCTTCTCTGCAACAAGGTA
JMFF030O06+ GTCACAATGACCTTCTCTGCAACAAGGTA
JMFF032O17+ GGTGGTCACAATGACCTTCTCTGCAACAAGGTA
JMSF015F12+ CAAGGTA
JMFF033E05+ ACAAGGTA
JMFF022B11+ GATGTACTGTTCGTCATCATTGTGTTTGGTGGTCACAATGACCTTCTCTGCAACAAGGTA
JMFF003G05+ GATGTACTGTTCGTCATCATTGTGTTTGGTGGTCACAATGACCTTCTCTGCAACAAGGTA
JMFF039P24+ AACAAGGTA
JMFF005G01+ AACAAGGTA
JMFF042L10+ GATGTACTGTTCGTCATCATTGTGTTTGGTGGTCACAATGACCTTCTCTGCAACAAGGTA
JMFF045O21+ GATGTACTGTTCGTCATCATTGTGTTTGGTGGTCACAATGACCTTCTCTGCAACAAGGTA
JMSF020O04+ GATGTACTGTTCGTCATCATTGTGTTTGGTGGTCACAATGACCTTCTCTGCAACAAGGTA
                      ____________________________________________________________
consensus GATGTACTGTTCGTCATCATTGTGTTTGGTGGTCACAATGACCTTCTCTGCAACAAGGTA
 
. : . : . : . : . : . :
JMSF047P08+ TGCTGAGTAGAAA-CCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMSF040E02+ TGCTGAGTAGAAA-CCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMFF030O06+ TGCTGAGTAGAAA-CCCACACCCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMFF032O17+ TGCTGAGTAGAAA-CCCACACCCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMSF015F12+ TGCTGAGTAGAAA-CCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMFF033E05+ TGCTGAGTAGAAA-CCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMFF022B11+ TGCTGAGTAGAAA-CCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMFF003G05+ TGCTGAGTAGAAA-CCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMFF039P24+ TGCTGAGTAGAAA-CCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMFF005G01+ TGCTGAGTAGAAACCCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMFF042L10+ TGCTGAGTAGAAA-CCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMFF024C07+ CCCGATCATGCTCACATCGGCACCAGCCTGC
JMFF045O21+ TGCTGAGTAGAAA-CCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
JMSF020O04+ TGCTGAGTAGAAA-CCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
                      ____________________________________________________________
consensus TGCTGAGTAGAAA-CCCACA-CCAAATTGCCCGATCATGCTCACATCGGCACCAGCCTGC
 
. : . : . : . : . : . :
JMSF047P08+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMSF040E02+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMFF030O06+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMFF032O17+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMSF015F12+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMFF033E05+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMFF022D19+ CTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMFF022B11+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMFF003G05+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMFF039P24+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMFF005G01+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMFF042L10+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMFF024C07+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMFF045O21+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
JMSF020O04+ AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
                      ____________________________________________________________
consensus AATGCTTCCATAAATTCCTTGGTTCCTGATCTCGCAATTGTACCCAAGTTGTTCACCAAA
 
. : . : . : . : . : . :
JMSF047P08+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMSF040E02+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMFF030O06+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMFF032O17+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMSF015F12+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMFF033E05+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMFF022D19+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMFF022B11+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMFF003G05+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMFF039P24+ TCTGCTTTGGCCATGCCGACACCGCTACCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMFF003A19+ A
JMFF005G01+ TCTGCTTTGGCCATGCCGACACCGCTACCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMFF042L10+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMFF024C07+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMFF045O21+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
JMSF020O04+ TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
                      ____________________________________________________________
consensus TCTGCTTTGGCCATGCCGACACCGCTATCAATAATGGAGAGAGTCTTGTTAGTCTTGTCA
 
. : . : . : . : . : . :
JMSF047P08+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMSF040E02+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF030O06+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF032O17+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMSF015F12+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF033E05+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF022D19+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF022B11+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF003G05+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF039P24+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF003A19+ GGAACAAGGCGAANGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF005G01+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF042L10+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF024C07+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMFF045O21+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
JMSF020O04+ GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
                      ____________________________________________________________
consensus GGAACAAGGCGAATGAAGAGCTCAGGCTGAGCATCGAGCTTGCTCTTGTCAGTCAAGCTC
 
. : . : . : . : . : . :
JMSF047P08+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMSF040E02+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF030O06+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF032O17+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMSF015F12+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF033E05+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF022D19+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF022B11+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF003G05+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF039P24+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF003A19+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF005G01+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF042L10+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF024C07+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMFF045O21+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
JMSF020O04+ TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
                      ____________________________________________________________
consensus TCAAACCGGATCTTATCCAAGGCGTCAGAGGCGTTGCTAATGAGCTCACGGAGGAAAATC
 
. : . : . : . : . : . :
JMSF047P08+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMSF040E02+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF030O06+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF032O17+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMSF015F12+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF033E05+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF022D19+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF022B11+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF003G05+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF039P24+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF003A19+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF005G01+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF042L10+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF024C07+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMFF045O21+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
JMSF020O04+ TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGGAGCTGGTTGATCTCCGCCTGG
                      ____________________________________________________________
consensus TCCTTGTTGCTGTAGAACGTGTTGATGATCAAGCTGAGCAGCTGGTTGATCTCCGCCTGG
 
. : . : . : . : . : . :
JMSF047P08+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMSF040E02+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF030O06+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF032O17+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMSF015F12+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF033E05+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF022D19+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF022B11+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF003G05+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF039P24+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF003A19+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF005G01+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF042L10+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF024C07+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
JMFF045O21+ AATGCGAAGGTCTCCGCCTCGGCCATATGAACATCCGCCATTGATCACAGAACTCTGTAG
JMSF020O04+ AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
                      ____________________________________________________________
consensus AATGCGAAGGTCTCCGCCTCGGCCATCTGAACATCCGCCATTGATCACAGAACTCTGTAG
 
. : . : . : . : . : . :
JMSF047P08+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMSF040E02+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF030O06+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF032O17+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMSF015F12+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF033E05+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF022D19+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF022B11+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF003G05+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF039P24+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF003A19+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF005G01+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF042L10+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF024C07+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMFF045O21+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
JMSF020O04+ CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
                      ____________________________________________________________
consensus CCTTTATGAACGCTCGCGGGGAAGATCTTAGAAACGCAAAGAAAGAAAGCGCAGAGAGAT
 
. : . : . : . : . : . :
JMSF047P08+ CGAGAACGACGTATAACCGCTTTTGTCCTGA
JMSF040E02+ CGAGAACGACGTATAACCGCTTTTGTCCTGATC
JMFF030O06+ CGAGAACGACGTATAACCGCTTTTGTCCTGA
JMFF032O17+ CGAGAACGACGTATAACCGCTTTTGTCCTGAT
JMSF015F12+ CGAGAACGACGTATAACCGCTTTTGTCCTGATC
JMFF033E05+ CGAGAACGACGTATAACCGCTTTTGTCCTGAT
JMFF022D19+ CGAGAACGACGTATAACCGCTTTTGTCCTGATC
JMFF022B11+ CGAGAACGACGTATAACCGCTTTTGTCCTGATC
JMFF003G05+ CGAGAACGACGTATAACCGCTTTTGTCCT
JMFF039P24+ CGAGAACGACGTATAACCGCTTTTGTCCTGATGACTCT
JMFF003A19+ CGAGAACGACGTATAACCGCTTTTGTCCTGAT
JMFF005G01+ CGAGAACGACGTATAACCGCTTTTGTCCTGATGACTCT
JMFF042L10+ CGAGAACGACGTATAACCGCTTTTGTCCTGATGACTCT
JMFF024C07+ CGAGAACGACGTATAACCGCTTTTGTCCTGATGACTCT
JMFF045O21+ CGAGAACGACGTATAACCGCTTTTGTCCTGATGACTCTAATTGAAACGAAGAGTGGTGTG
JMSF020O04+ CGAGAACGACGTATAACCGCTTTTGTCCTGATGACTCTAATTGAAACGAAGAGTGGTGTG
                      ____________________________________________________________
consensus CGAGAACGACGTATAACCGCTTTTGTCCTGATGACTCTAATTGAAACGAAGAGTGGTGTG
 
. : . : . : . : . : . :
JMFF045O21+ TTNATATACGCGAGTAGGGAAAACGAGTGTATTCT
JMSF020O04+ TTTATATACGCGAGTAGGGAAAACGAGTGTATTCTAGGTCCTTCTATTGGCGAAGGAAAG
                      ____________________________________________________________
consensus TTTATATACGCGAGTAGGGAAAACGAGTGTATTCTAGGTCCTTCTATTGGCGAAGGAAAG
 
. : . : . : . : . : . :
JMSF020O04+ TTGAAGGCGAAAAATATTGGATTTCTCAAGCTTCTGGAGTATTCTACTACCCTCCAGATC
                      ____________________________________________________________
consensus TTGAAGGCGAAAAATATTGGATTTCTCAAGCTTCTGGAGTATTCTACTACCCTCCAGATC