Previous Contig 005922:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009N17Sequence541005922 (6)681013925 (4)gb:AK176219_18182074e-92Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-10-G19.
JMFF027J12Sequence537005922 (6)661013925 (4)gb:AK176219_18182073e-90Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-10-G19.
JMFF036K07Sequence598005922 (6)521013925 (4)gb:AK176219_18182071e-73Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-10-G19.
JMSF020L15Sequence674005922 (6)783022938pir|F96818|F968181e-54hypothetical protein F9K20.4 [imported] - Arabidopsis thaliana>gb:AE005173_89541
JMSF051B11Sequence630005922 (6)783024450gb:AK176219_1818207e-108Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-10-G19.
JMSF051D02Sequence628005922 (6)734013925 (4)gb:AK176219_1818207e-102Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-10-G19.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051B11+ CCCTGGGGCAGCCCAA
JMSF051D02+ CTGGGGCAGCCCAA
JMSF020L15+ CTGGGGCAGCCCAA
                      ____________________________________________________________
consensus CCCTGGGGCAGCCCAA
 
. : . : . : . : . : . :
JMSF051B11+ ATGGGCAATATTGTTTGAAACTCGGATCACCGAGTCATCATTAAGAGAAGTGTCACATCT
JMSF051D02+ ATGGGCAATATTGTTTGAAACTCGGATCACCGAGTCATCATTAAGAGAAGTGTCACATCT
JMFF036K07+ TCT
JMSF020L15+ ATGGGCAATATTGTTTGAAACTCGGATCACCGAGTCATCATTAAGAGAAGTGTCACATCT
                      ____________________________________________________________
consensus ATGGGCAATATTGTTTGAAACTCGGATCACCGAGTCATCATTAAGAGAAGTGTCACATCT
 
. : . : . : . : . : . :
JMSF051B11+ TTGCGAGGAGTACTGCCTGACCACGAAGAACAATCGACGGCTTAGACCTCTGTTCCACAT
JMSF051D02+ TTGCGAGGAGTACTGCCTGACCACGAAGAACAATCGACGGCTTAGACCTCTGTTCCACAT
JMFF036K07+ TTGCGAGGAGTACTGCCTGACCACGAAGAACAATCGACGGCTTAGACCTCTGTTCCACAT
JMFF027J12+ AT
JMFF009N17+ CCACAT
JMSF020L15+ TTGCGAGGAGTACTGCCTGACCACGAAGAACAATCGACGGCTTAGACCTCTGTTCCACAT
                      ____________________________________________________________
consensus TTGCGAGGAGTACTGCCTGACCACGAAGAACAATCGACGGCTTAGACCTCTGTTCCACAT
 
. : . : . : . : . : . :
JMSF051B11+ TCCCAATACATGCTAGATGAATTTCCTGGCTGGAGGAATACGTAAGAGGAGCAGGCTACG
JMSF051D02+ TCCCAATACATGCTAGATGAATTTCCTGGCTGGAGGAATACGTAAGAGGAGCAGGCTACG
JMFF036K07+ TCCCAATACATGCTAGATGAATTTCCTGGCTGGAGGAATACGTAAGAGGAGCAGGCTACG
JMFF027J12+ TCCCAATACATGCTAGATGAATTTCCTGGCTGGAGGAATACGTAAGAGGAGCAGGCTACG
JMFF009N17+ TCCCAATACATGCTAGATGAATTTCCTGGCTGGAGGAATACGTAAGAGGAGCAGGCTACG
JMSF020L15+ TCCCAATACATGCTAGATGAATTTCCTGGCTGGAGGAATACGTAAGAGGAGCAGGCTACG
                      ____________________________________________________________
consensus TCCCAATACATGCTAGATGAATTTCCTGGCTGGAGGAATACGTAAGAGGAGCAGGCTACG
 
. : . : . : . : . : . :
JMSF051B11+ ACGTGCAGGTGAGGTCGGCGACGACAACGAAGCGACTCACCGACTGCGACAGTGCGACGA
JMSF051D02+ ACGTGCAGGTGAGGTCGGCGACGACAACGAAGCGACTCACCGACTGCGACAGTGCGACGA
JMFF036K07+ ACGTGCAGGTGAGGTCGGCGACGACAACGAAGCGACTCACCGACTGCGACAGTGCGACGA
JMFF027J12+ ACGTGCAGGTGAGGTCGGCGACGACAACGAAGCGACTCACCGACTGCGACAGTGCGACGA
JMFF009N17+ ACGTGCAGGTGAGGTCGGCGACGACAACGAAGCGACTCACCGACTGCGACAGTGCGACGA
JMSF020L15+ ACGTGCAGGTGAGGTCGGCGACGACAACGAAGCGACTCACCGACTGCGACAGTGCGACGA
                      ____________________________________________________________
consensus ACGTGCAGGTGAGGTCGGCGACGACAACGAAGCGACTCACCGACTGCGACAGTGCGACGA
 
. : . : . : . : . : . :
JMSF051B11+ TGACCGGACGGCTGTAGTGACGGCGACGACTGGACGGCTAGAAACTTTGGACGACGGGCA
JMSF051D02+ TGACCGGACGGCTGTAGTGACGGCGACGACTGGACGGCTAGAAACTTTGGACGACGGGCA
JMFF036K07+ TGACCGGACGGCTGTAGTGACGGCGACGACTGGACGGCTAGAAACTTTGGACGACGGGCA
JMFF027J12+ TGACCGGACGGCTGTAGTGACGGCGACGACTGGACGGCTAGAAACTTTGGACGACGGGCA
JMFF009N17+ TGACCGGACGGCTGTAGTGACGGCGACGACTGGACGGCTAGAAACTTTGGACGACGGGCA
JMSF020L15+ TGACCGGACGGCTGTAGTGACGGCGACGACTGGACGGCTAGAAACTTTGGACGACGGGCA
                      ____________________________________________________________
consensus TGACCGGACGGCTGTAGTGACGGCGACGACTGGACGGCTAGAAACTTTGGACGACGGGCA
 
. : . : . : . : . : . :
JMSF051B11+ ACGGCGACGCTAACGTCTGTGGACTGTGTCGTGTGGCTGGAGGTTTGCGACTTTGTGTTT
JMSF051D02+ ACGGCGACGCTAACGTCTGTGGACTGTGTCGTGTGGCTGGAGGTTTGCGACTTTGTGTTT
JMFF036K07+ ACGGCGACGCTAACGTCTGTGGACTGTGTCGTGTGGCTGGAGGTTTGCGACTTTGTGTTT
JMFF027J12+ ACGGCGACGCTAACGTCTGTGGACTGTGTCGTGTGGCTGGAGGTTTGCGACTTTGTGTTT
JMFF009N17+ ACGGCGACGCTAACGTCTGTGGACTGTGTCGTGTGGCTGGAGGTTTGCGACTTTGTGTTT
JMSF020L15+ ACGGCGACGCTAACGTCTGTGGACTGTGTCGTGTGGCTGGAGGTTTGCGACTTTGTGTTT
                      ____________________________________________________________
consensus ACGGCGACGCTAACGTCTGTGGACTGTGTCGTGTGGCTGGAGGTTTGCGACTTTGTGTTT
 
. : . : . : . : . : . :
JMSF051B11+ GAGTACTTGGGCAGATTTTATTTGAACTTGTGTACAGTGGCGGACCCAGGATTTTTCTGG
JMSF051D02+ GAGTACTTGGGCAGATTTTATTTGAACTTGTGTACAGTGGCGGACCCAGGATTTTTCTGG
JMFF036K07+ GAGTACTTGGGCAGATTTTATTTGAACTTGTGTACAGTGGCGGACCCAGGATTTTTCTGG
JMFF027J12+ GAGTACTTGGGCAGATTTTATTTGAACTTGTGTACAGTGGCGGACCCAGGATTTTTCTGG
JMFF009N17+ GAGTACTTGGGCAGATTTTATTTGAACTTGTGTACAGTGGCGGACCCAGGATTTTTCTGG
JMSF020L15+ GAGTACTTGGGCAGATTTTATTTGAACTTGTGTACAGTGGCGGACCCAGGATTTTTCTGG
                      ____________________________________________________________
consensus GAGTACTTGGGCAGATTTTATTTGAACTTGTGTACAGTGGCGGACCCAGGATTTTTCTGG
 
. : . : . : . : . : . :
JMSF051B11+ CAGTTGCGACTTGTGAGTTGCGAGGCAGCGGAGTCGTCGGGTGGTGGCGCTAGTGGTGGC
JMSF051D02+ CAGTTGCGACTTGTGAGTTGCGAGGCAGCGGAGTCGTCGGGTGGTGGCGCTAGTGGTGGC
JMFF036K07+ CAGTTGCGACTTGTGAGTTGCGAGGCAGCGGAGTCGTCGGGTGGTGGCGCTAGTGGTGGC
JMFF027J12+ CAGTTGCGACTTGTGAGTTGCGAGGCAGCGGAGTCGTCGGGTGGTGGCGCTAGTGGTGGC
JMFF009N17+ CAGTTGCGACTTGTGAGTTGCGAGGCAGCGGAGTCGTCGGGTGGTGGCGCTAGTGGTGGC
JMSF020L15+ CAGTTGCGACTTGTGAGTTGCGAGGCAGCGGAGTCGTCGGGTGGTGGCGCTAGTGGTGGC
                      ____________________________________________________________
consensus CAGTTGCGACTTGTGAGTTGCGAGGCAGCGGAGTCGTCGGGTGGTGGCGCTAGTGGTGGC
 
. : . : . : . : . : . :
JMSF051B11+ GTCGGAACTCAGGGAACTCACGGAGGCTGAGAGCAGACGGAACTCACGGAAGAGAAGAGG
JMSF051D02+ GTCGGAACTCAGGGAACTCACGGAGGCTGAGAGCAGACGGAACTCACGGAAGAGAAGAGG
JMFF036K07+ GTCGGAACTCAGGGAACTCACGGAGGCTGAGAGCAGACGGAACTCACGGAAGAGAAGAGG
JMFF027J12+ GTCGGAACTCAGGGAACTCACGGAGGCTGAGAGCAGACGGAACTCACGGAAGAGAAGAGG
JMFF009N17+ GTCGGAACTCAGGGAACTCACGGAGGCTGAGAGCAGACGGAACTCACGGAAGAGAAGAGG
JMSF020L15+ GTCGGAACTCAGGGAACTCACGGAGGCTGAGAGCAGACGGAACTCACGGAAGAGAAGAGG
                      ____________________________________________________________
consensus GTCGGAACTCAGGGAACTCACGGAGGCTGAGAGCAGACGGAACTCACGGAAGAGAAGAGG
 
. : . : . : . : . : . :
JMSF051B11+ AGAGACGGTCAGACGGAACTCGGAAGACTGGAAGAGAAGAGGAGACTTGCGGTGGCGTCG
JMSF051D02+ AGAGACGGTCAGACGGAACTCGGAAGACTGGAAGAGAAGAGGAGACTTGCGGTGGCGTCG
JMFF036K07+ AGAGACGGTCAGACGGAACTCGGAAGACTGGAAGAGAAGAGGAGACTTGCGGTGGCGTCG
JMFF027J12+ AGAGACGGTCAGACGGAACTCGGAAGACTGGAAGAGAAGAGGAGACTTGCGGTGGCGTCG
JMFF009N17+ AGAGACGGTCAGACGGAACTCGGAAGACTGGAAGAGAAGAGGAGACTTGCGGTGGCGTCG
JMSF020L15+ AGAGACGGTCAGACGGAACTCGGAAGACTGGAAGAGAAGAGGAGACTTGCGGTGGCGTCG
                      ____________________________________________________________
consensus AGAGACGGTCAGACGGAACTCGGAAGACTGGAAGAGAAGAGGAGACTTGCGGTGGCGTCG
 
. : . : . : . : . : . :
JMSF051B11+ GGCTTCAGGCTTC
JMSF051D02+ GGCTTCAGGCTTC
JMFF036K07+ GGCTTCAGGCTTCAGCTCTTCTCGCATCGCAGCAGGCAATGAAACAAATGAAATT
JMFF027J12+ GGCTTCAGGCTTCAGCTCTTCTCGCATCGCAGCAGGCAATGAAACAAATGAAATT
JMFF009N17+ GGCTTCAGGCTTCAGCTCTTCTCGCATCGCAGCAGGCAATGAAACAAATGAAATT
JMSF020L15+ GGCTTCAGGCTTCAGCTCTTCTCGCATCGCAGCAGGCAATGAAACAAATGAAATTAATTC
                      ____________________________________________________________
consensus GGCTTCAGGCTTCAGCTCTTCTCGCATCGCAGCAGGCAATGAAACAAATGAAATTAATTC