Previous Contig 005921:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031C02Sequence601005921 (5)gb:AY034924_15597097e-39Arabidopsis thaliana unknown protein (At4g27585) mRNA, complete cds.>gb:AY059109727011119 (5)gb:AY085995_15710561e-37Arabidopsis thaliana clone 205622 mRNA, complete sequence.
JMFF051O20Sequence623005921 (5)gb:AP004698_18436094e-40Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049488011119 (5)
JMSF002O24Sequence337005921 (5)gb:AY034924_15597090.024Arabidopsis thaliana unknown protein (At4g27585) mRNA, complete cds.>gb:AY059109749011119 (5)gb:AY034924_15597099e-49Arabidopsis thaliana unknown protein (At4g27585) mRNA, complete cds.>gb:AY059109
JMSF020L11Sequence720005921 (5)gb:AP004698_18436095e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P049809011119 (5)gb:AY034924_15597094e-50Arabidopsis thaliana unknown protein (At4g27585) mRNA, complete cds.>gb:AY059109
JMSF029D12Sequence678005921 (5)gb:AY034924_15597099e-60Arabidopsis thaliana unknown protein (At4g27585) mRNA, complete cds.>gb:AY059109764011119 (5)gb:AY034924_15597092e-46Arabidopsis thaliana unknown protein (At4g27585) mRNA, complete cds.>gb:AY059109

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029D12+ AGAGTATCCCTCT
JMSF020L11+ T
                      ____________________________________________________________
consensus AGAGTATCCCTCT
 
. : . : . : . : . : . :
JMSF029D12+ CCTCAAAAGTCTTGTCCAGAGTGATCTTACCAAGCTCACTACGCATAGTTGTTTGAGCAA
JMSF020L11+ CCTCAAAAGTCTTGTCCAGAGTGATCTTACCAAGCTCACTACGCATAGTTGTTTGAGCAA
                      ____________________________________________________________
consensus CCTCAAAAGTCTTGTCCAGAGTGATCTTACCAAGCTCACTACGCATAGTTGTTTGAGCAA
 
. : . : . : . : . : . :
JMSF029D12+ GTTGAATCACAGCATACAACGGATTCTCAACTCCATATGAAGCCAGTTTAGGATC-AACT
JMFF031C02+ AACT
JMFF051O20+ GGATTCTCAACTCCATATGAAGCCAG-TTAGGATCNAACT
JMSF020L11+ GTTGAATCACAGCATACAACGGATTCTCAACTCCATATGAAGCCAGTTTAGGATC-AACT
                      ____________________________________________________________
consensus GTTGAATCACAGCATACAACGGATTCTCAACTCCATATGAAGCCAGTTTAGGATC-AACT
 
. : . : . : . : . : . :
JMSF029D12+ ATCTTCACATAGAGAACACCGTCAATAAGAATGCTGACATTGTCCTTGGTAATAGCCGAC
JMFF031C02+ ATCTTCACATAGAGAACACCGTCAATAAGAATGCTGACATTGTCCTTGGTAATAGCCGAC
JMFF051O20+ ATCTTCACATAGAGAACACCGTCAATAAGAATGCTGACATTGTCCTTGGTAATAGCCGAC
JMSF020L11+ ATCTTCACATAGAGAACACCGTCAATAAGAATGCTGACATTGTCCTTGGTAATAGCCGAC
                      ____________________________________________________________
consensus ATCTTCACATAGAGAACACCGTCAATAAGAATGCTGACATTGTCCTTGGTAATAGCCGAC
 
. : . : . : . : . : . :
JMSF029D12+ TGATCCGGAATGGGAATGGCCTCTTCCTTGAGGGAATGAACATACGCAATTTTGTCTACT
JMFF031C02+ TGATCCGGAATGGGAATGGCCTCTTCCTTGAGGGAATGAACATACGCAATTTTGTCTACT
JMFF051O20+ TGATCCGGAATGGGAATGGCCTCTTCCTTGAGGGAATGAACATACGCAATTTTGTCTACT
JMSF020L11+ TGATCCGGAATGGGAATGGCCTCTTCCTTGAGGGAATGAACATACGCAATTTTGTCTACT
                      ____________________________________________________________
consensus TGATCCGGAATGGGAATGGCCTCTTCCTTGAGGGAATGAACATACGCAATTTTGTCTACT
 
. : . : . : . : . : . :
JMSF029D12+ AACGGAATCAACACGTGGATTCCAGGAGTCAATGTCTTCACATACCTCCCGAATCGCTCA
JMFF031C02+ AACGGAATCAACACGTGGATTCCAGGAGTCAATGTCTTCACATACCTCCCGAATCGCTCA
JMFF051O20+ AACGGAATCAACACGTGGATTCCAGGAGTCAATGTCTTCACATACCTCCCGAATCGCTCA
JMSF020L11+ AACGGAATCAACACGTGGATTCCAGGAGTCAATGTCTTCACATACCTCCCGAATCGCTCA
                      ____________________________________________________________
consensus AACGGAATCAACACGTGGATTCCAGGAGTCAATGTCTTCACATACCTCCCGAATCGCTCA
 
. : . : . : . : . : . :
JMSF029D12+ ATGACGAAAGCCTTCTTCTCGGGCACAATCCGAACCCCCCAGTTCATAGGTGGCGGAATC
JMSF002O24+ ATCCGAACCCCCCAGTTCATAGGTGGCGGAATC
JMFF031C02+ ATGACGAAAGCCTTCTTCTCGGGCACAATCCGAACCCCCCAGTTCATAGGTGGCGGAATC
JMFF051O20+ ATGACGAAAGCCTTCTTCTCGGGCACAATCCGAACCCCCCAGTTCATAGGTGGCGGAATC
JMSF020L11+ ATGACGAAAGCCTTCTTCTCGGGCACAATCCGAACCCCCCAGTTCATAGGTGGCGGAATC
                      ____________________________________________________________
consensus ATGACGAAAGCCTTCTTCTCGGGCACAATCCGAACCCCCCAGTTCATAGGTGGCGGAATC
 
. : . : . : . : . : . :
JMSF029D12+ TCATAC-----CTGGAGCTAGGATCGCGAGCATTACGGAATTGGCGGACAGCGGTGTAGC
JMSF002O24+ TCATAC-----CTGGAGCTAGGATCGCGAGCATTACGGAATTGGCGGACAGCGGTGTAGC
JMFF031C02+ TCATAC-----CTGGAGCTAGGATCGCGAGCATTACGGAATTGGCGGACAGCGGTGTAGC
JMFF051O20+ TCATAC-----CTGGAGCTAGGATCGCGAGCATTACGGAATTGGCGGACAGCGGTGTAGC
JMSF020L11+ TCATACCTAAACTGGAGCTAGGATCGCGAGCATTACGGAATTGGCGGACAGCGGTGTAGC
                      ____________________________________________________________
consensus TCATAC-----CTGGAGCTAGGATCGCGAGCATTACGGAATTGGCGGACAGCGGTGTAGC
 
. : . : . : . : . : . :
JMSF029D12+ TGAAGGGGGAGGGATTACGCGGCGCCGAGAGACGATTGGCGAGAACGGAAGACTGCCCAA
JMSF002O24+ TGAAGGGGGAGGGATTACGCGGCGCCGAGAGACGATTGGCGAGAACGGAAGACTGCCCAA
JMFF031C02+ TGAAGGGGGAGGGATTACGCGGCGCCGAGAGACGATTGGCGAGAACGGAAGACTGCCCAA
JMFF051O20+ TGAAGGGGGAGGGATTACGCGGCGCCGAGAGACGATTGGCGAGAACGGAAGACTGCCCAA
JMSF020L11+ TGAAGGGGGAGGGATTACGCGGCGCCGAGAGACGATTGGCGAGAACGGAAGACTGCCCAA
                      ____________________________________________________________
consensus TGAAGGGGGAGGGATTACGCGGCGCCGAGAGACGATTGGCGAGAACGGAAGACTGCCCAA
 
. : . : . : . : . : . :
JMSF029D12+ GAATGGAAGAAGAAGCGGTAGAGATGGCTCGGGCGGCCCATGACGGCGGAACAGATTGGA
JMSF002O24+ GAATGGAAGAAGAAGCGGTAGAGATGGCTCGGGCGGCCCATGACGGCGGAACAGATTGGA
JMFF031C02+ GAATGGAAGAAGAAGCGGTAGAGATGGCTCGGGCGGCCCATGACGGCGGAACAGATTGGA
JMFF051O20+ GAATGGAAGAAGAAGCGGTAGAGATGGCTCGGGCGGCCCATGACGGCGGAACAGATTGGA
JMSF020L11+ GAATGGAAGAAGAAGCGGTAGAGATGGCTCGGGCGGCCCATGACGGCGGAACAGATTGGA
                      ____________________________________________________________
consensus GAATGGAAGAAGAAGCGGTAGAGATGGCTCGGGCGGCCCATGACGGCGGAACAGATTGGA
 
. : . : . : . : . : . :
JMSF029D12+ GGAGGTGCCGTATCTTGCTGAGATTACTAGATTTCACGATGTTGTTCATTGCTACTTCTC
JMSF002O24+ GGAGGTGCCGTATCTTGCTGAGATTACTAGATTTCACGATGTTGTTCATTGCTACTTCTC
JMFF031C02+ GGAGGTGCCGTATCTTGCTGAGATTACTAGATTTCACGATGTTGTTCATTGCTACTTCTC
JMFF051O20+ GGAGGTGCCGTATCTTGCTGAGATTACTAGATTTCACGATGTTGTTCATTGCTACTTCTC
JMSF020L11+ GGAGGTGCCGTATCTTGCTGAGATTACTAGATTTCACGATGTTGTTCATTGCTACTTCTC
                      ____________________________________________________________
consensus GGAGGTGCCGTATCTTGCTGAGATTACTAGATTTCACGATGTTGTTCATTGCTACTTCTC
 
. : . : . : . : . : . :
JMSF029D12+ CGATTCAGTTATCTGAGCTAGAAACCGAAATTAAACTCAAAAAGATCCGATTGCAGTCTG
JMSF002O24+ CGATTCAGTTATCTGAGCTAGAAACCGAAATTAAACTCAAAAAGATCCGATTGCAGTCTG
JMFF031C02+ CGATTCAGTTATCTGAGCTAGAAACCGAAATTAAACTCAAAAAGATCCGATTGCAGTCTG
JMFF051O20+ CGATTCAGTTATCTGAGCTAGAAACCGAAATTAAACTCAAAAAGATCCGATTGCAGTCTG
JMSF020L11+ CGATTCAGTTATCTGAGCTAGAAACCGAAATTAAACTCAAAAAGATCCGATTGCAGTCTG
                      ____________________________________________________________
consensus CGATTCAGTTATCTGAGCTAGAAACCGAAATTAAACTCAAAAAGATCCGATTGCAGTCTG
 
. : . : . : . : . : . :
JMSF029D12+ AAGGAGCTAG
JMSF002O24+ AAGGAGCT
JMFF031C02+ AAGGAGCTAGAGAAGGAG-TTTTCAGTTTTCTTGATTAATAAGCCCTAGT
JMFF051O20+ AAGGAGCTAGAGAAGGAG-TTTTCAGTTTTCTTGATTAATAAGCCCTAGT
JMSF020L11+ AAGGAGCTAGAGAAGGAGTTTTTCAGTTTTCTTGATTAATAAGCCCTAGTAAAACCCATT
                      ____________________________________________________________
consensus AAGGAGCTAGAGAAGGAG-TTTTCAGTTTTCTTGATTAATAAGCCCTAGTAAAACCCATT